FAQ-3835
What is the sequence of the UDI 5' Adapter?
(5’–3') CTACACGACGCTCTTCCGATCT
Related products
QIAseq miRNA Library Kit
Optimized reaction chemistry enables robust, miRNA-specific libraries while minimizing reaction biases and eliminating adapter dimers. Unique Molecular Indices (UMIs) tag each miRNA at an early stage, eliminating PCR and sequencing bias. Analyze miRNA-seq data with ease using the GeneGlobe-integrated RNA-seq Analysis Portal – an intuitive, web-based data analysis solution created for biologists and included with QIAseq Stranded RNA Library Kits.
High-throughput sequencing on Illumina NovaSeq instruments is now possible with 768 unique dual indices.
Important note: We highly recommend that data is only compared with RNA-seq libraries that use the same type of indices (single or unique dual indices) in order to ensure experimental consistency. Samples and data generated with single-end indexed libraries should only be compared with other samples and data generated with single-end indices. Samples and data generated with unique dual indices should only be compared to other samples and data generated with unique dual indices.
Want to try this solution for the first time? Request a quote for a trial kit.

