Looking for a quick way to design experiments?
Try the Workflow Configurator. A convenient tool to build experimental workflows and find products to match your needs.
FAQ-3672

What is the sequence of the QIAseq miRNA NGS 5’ Adapter?

When inputting the adapter sequence for adapter trimming, the following DNA sequence should be used:

(5’–3')  GTTCAGAGTTCTACAGTCCGACGATC

Can’t find what you are looking for?

Browse the FAQ base with our FAQ search.