FAQ-3672
What is the sequence of the QIAseq miRNA NGS 5’ Adapter?
When inputting the adapter sequence for adapter trimming, the following DNA sequence should be used:
(5’–3') GTTCAGAGTTCTACAGTCCGACGATC
(5’–3') GTTCAGAGTTCTACAGTCCGACGATC
QIA Agent: A smarter way to search
Compare products and build your method with our AI tool. Find what you need in seconds – on one page.
Enzymes for molecular biology
Explore high-quality enzymes; now available as individual products.
Products and tools for your targets
Explore targets and pathways in their scientific context, find and customize products to study them, analyze data and plan follow-up studies – all in GeneGlobe.
