Why is there an asterisk for my miScript Primer Assays?
The asterisk in the product name of a miScript Primer Assay is part of the miRNA name for which this primer is designed. Besides the miRNA forms without an asterisk you will also find a so called miRNA* (miRNA star form) listed in miRBase. miRNA and miRNA* are the two strands of the double-stranded RNA product of dicer processing of the stem loop precursor miRNA. The miRNA nomenclature in miRBase is based on the precursor microRNAs, therefore there will be a miRNA-xx and a miRNA-xx* form. We are offering miScript Primer Assays for both forms.
Example: Mouse miR-133a and miR-133a* are two different sequences, coming from the same precursor:
mmu-miR-133a* Sequence 5'-gcugguaaaauggaaccaaau- 3'
mmu-miR-133a Sequence 5'- uugguccccuucaaccagcugu - 3'
Please see also FAQ 2179 for additional information.
