FAQ-1363
What information is provided with FlexiPlate siRNAs?
With FlexiPlate siRNA, you receive a CD with an Excel file that contains the following information (example):
- Plate ID: 1
- Row: A
- Column: 2
- Entrez Gene ID: 9210
- NCBI Gene Symbol: BMP15
- Gene description: bone morphogenetic protein 15
- siRNA target sequence (for HP GenomeWide siRNAs): TCGGAGTATAAGTATGAATTCCAA
- RefSeq ID (mRNA accession): NM_00222
- mRNA location: 756
- mRNA region: CDS
- Catalog number SIxxxxxx

