FlexiPlate siRNA

For highly flexible, economical RNAi screening

S_2781_GEF_FlexiPlate_s
Configure at GeneGlobe
Find or custom design the right target-specific assays and panels to research your biological targets of interest.

FlexiPlate siRNA, 0.1 nmol

Cat no. / ID.   1027411

Custom siRNA set in 96-well plate format, 0.1 nmol
Browse product options to see pricing
Plate type
96-well
384-well
Quantity
0.1 nmol
1 nmol
0.25 nmol
The FlexiPlate siRNA is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.
Configure at GeneGlobe
Find or custom design the right target-specific assays and panels to research your biological targets of interest.

Features

  • Maximum flexibility to select siRNAs, scales, and plate layout
  • Economical options allow screening of more target genes
  • Fast and easy access via GeneGlobe
  • Cutting-edge siRNA design minimizes the risk of off-target effects
  • Rapid delivery enables screening without delay

Product Details

FlexiPlate siRNA provides highly flexible RNAi screening and is available at 0.1 nmol, 0.25 nmol, and 1 nmol scales in 96-well plates, and at 0.1 nmol and 0.25 nmol scales in 384-well plates for a choice of target genes. For maximum flexibility, siRNAs can be selected and plate layout specified at the GeneGlobe Web portal. Lists of preselected siRNAs are also available for many gene families. siRNAs have been designed using HP OnGuard siRNA Design, which incorporates neural network technology, proprietary homology analysis, and advanced features, such as 3' UTR/seed region analysis, asymmetry, SNP avoidance, and interferon motif avoidance.

Note: QIAGEN does not provide FlexiPlate siRNA in pools.

Performance

Cutting-edge siRNA design

Advances in the siRNA design process ensure that QIAGEN's highly innovative and sophisticated HP OnGuard siRNA Design delivers potent and specific siRNA. siRNAs are designed using neural-network technology based on an extremely large set of data from RNAi experiments. siRNA design is then checked for homology to all other sequences of the genome using an up-to-date, nonredundant sequence database and a proprietary homology analysis tool. HP OnGuard siRNA Design incorporates many unique and advanced features (see table).

HP OnGuard siRNA Design features
Feature Description References
Neural-network technology siRNA design uses the BioPredsi neural-network, which is based on an extremely large RNAi data set. 1-3
The world's largest siRNA validation project The design process was reinforced and improved by data from this project, in which QIAGEN scientists proved the effectiveness of thousands of siRNAs. A large number of druggable genome siRNAs have been proven to provide at least 70% knockdown during this project. 4
Homology analysis Analysis uses a proprietary tool and an up-to-date, nonredundant sequence database.  
Affymetrix GeneChip analysis Genomewide analysis enabled development of siRNA design improvements that minimize off-target effects.  
Up-to-date siRNA target sequences Current data from NCBI databases ensure accurate design.  
Asymmetry siRNAs are designed with unequal stabilities of the base pairs at the 5' ends. This enables the antisense strand, which is less tightly bound at its 5' end, to enter RISC, while the sense strand is degraded. Asymmetry produces highly functional siRNAs and reduces the risk of off-target effects caused by the incorrect strand entering RISC. 5, 6
3' UTR/seed region analysis Analysis uses intelligently weighted, multi-parameter searches for matches of the seed region of the siRNA antisense strand with the 3' untranslated region of unintended mRNA targets (see text for further explanation). 7-12
SNP avoidance The RefSNP database is used to exclude siRNAs that span single nucleotide polymorphisms (SNPs). This increases siRNA potency, as an siRNA spanning a SNP will vary in its effectiveness.  
Interferon motif avoidance siRNAs are screened for multiple sequence motifs known to result in an interferon response. siRNAs with such motifs are rejected. 13, 14
3' UTR/seed region analysis

Several studies have shown that off-target effects may be caused by matches of the seed region of the siRNA antisense strand with the 3' untranslated region of unintended mRNA targets (see table). The seed region comprises 6 nucleotides in positions 2–7 of the antisense siRNA strand of the siRNA duplex. Matches such as these can contribute to downregulation of unintended targets due to the siRNA mimicking the action of an miRNA. siRNA designed at QIAGEN is analyzed for 3' UTR/seed region complementarity using a proprietary set of 3' UTR sequences derived from the human, rat, and mouse RefSeq databases. Each siRNA is aligned against these sequences to check for any homology that could contribute to miRNA-like, off-target effects.

Matches of 6 out of 6 nucleotides of the siRNA seed region with an unrelated target 3' UTR sequence are common and it is not necessary or practical to eliminate siRNAs showing such matches. More rarely, seed region matches in combination with 10 or more bases of additional homology are observed in an siRNA sequence. Such homologies have greater potential to result in off-target effects, and where possible these siRNAs are rejected in favor of others with less significant homology to unintended target genes.

For some targets, it is not possible to select siRNAs that do not show any such homologies. In these cases, EntrezGene IDs of the unrelated genes that could be unintended targets of the siRNA are provided at GeneGlobe. Observation of this type of homology does not necessarily mean that these genes will be affected by the siRNA. However, they can be considered potential unintended targets for follow up analysis, if warranted. >

Principle

FlexiPlate siRNA allows design of RNAi screening experiments to suit specific requirements. siRNAs for any human or mouse gene can be selected as well as any positive and negative controls required. With the user-friendly Web interface, siRNAs and controls can be placed in any of the wells of a 96-well or 384-well plate, or plate layout can be selected from a range of predefined layout patterns. siRNAs are provided in 0.1 nmol, 0.25 nmol, or 1 nmol scales, enabling economical screening using low or higher siRNA amounts, as required. The 0.1 nmol, 0.25 nmol, and 1 nmol scales are available in 96-well plates. The 0.1 nmol and 0.25 nmol scales are available in 384-well plates.

Procedure

The GeneGlobe Web portal makes it easy to search for siRNAs for genes of interest and to arrange plate layouts to suit screening experiments. Lists of gene names, Entrez Gene IDs, RefSeq IDs, siRNA names, or catalog numbers can be uploaded, making the process of plate ordering fast and easy. Order plates immediately or save for later changes and ordering. Easily download plate layouts for your records.

Applications

FlexiPlate siRNA enables RNAi applications including:

  • Pathway analysis
  • Follow-up screening experiments

Supporting data and figures

Specifications

FeaturesSpecifications
DesignPredesigned/HiPerformance siRNA Design Algorithm
FormatPlate
Target sequence providedYes
ModificationNo
SpeciesHuman, mouse
Guarantee/validationNo guarantee
Scale or yield0.1 nmol, 0.25 nmol, 1 nmol

Resources

Download Files (1)
Kit Handbooks (1)
For transfection of eukaryotic cells with siRNA and miRNA
Scientific Posters (1)
Poster for download
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)

FAQ

Which formats are available for FlexiPlate siRNA?

FlexiPlate siRNA is available in 3 different amounts: 0.1 nmol, 0.25 nmol, or 1 nmol per siRNA. Up to 4 human or mouse siRNAs can be selected per gene.

FlexiPlate siRNA is provided lyophilized in 96-well plates and is shipped at room temperature. siRNAs can be arranged in plates using the drag-and-drop tool at the GeneGlobe Web portal. Special formats are available on request: delivery in 384-well plates, delivery in solution and aliquoting.

 

FAQ-1358
How do I resuspend my FlexiPlate siRNAs?

FlexiPlate siRNAs are preannealed and dried down from a 10 µM solution in buffer. They should be resuspended in sterile RNase-free water only (you do not need siRNA buffer to resuspend the siRNAs).

To achieve a final siRNA stock concentration of 10 µM, resuspend:

  • 0.1 nmol siRNA in 10 µl
  • 0.25 nmol siRNA in 25 µl
  • 1 nmol siRNA in 100 µl

Mix gently and cover the plate with new sealing film. Allow siRNAs to dissolve for 30 minutes at 4°C with occasional shaking or gentle vortexing.

 

FAQ-1360
What is the composition of FlexiPlate siRNA buffer?

FlexiPlate siRNA buffer is 1x annealing buffer:

  • 30 mM HEPES (pH 7.4)
  • 100 mM Potassium Acetate
  • 2 mM Magnesium Acetate

 

FAQ-1361
What information is provided with FlexiPlate siRNAs?

With FlexiPlate siRNA, you receive a CD with an Excel file that contains the following information (example):

  • Plate ID: 1
  • Row: A
  • Column: 2
  • Entrez Gene ID: 9210
  • NCBI Gene Symbol: BMP15
  • Gene description: bone morphogenetic protein 15
  • siRNA target sequence (for HP GenomeWide siRNAs): TCGGAGTATAAGTATGAATTCCAA
  • RefSeq ID (mRNA accession): NM_00222
  • mRNA location: 756
  • mRNA region: CDS
  • Catalog number SIxxxxxx

 

FAQ-1363
How can I upload my gene list for FlexiPlate siRNA to GeneGlobe?

You can upload an Excel file with your gene list for FlexiPlate siRNA, including gene-specific information, to GeneGlobe. At the GeneGlobe site, an example file with details on how to enter information is provided.

 

FAQ-1364
What information about my gene or siRNA do I need to order FlexiPlate siRNA?

To locate and order specific FlexiPlate siRNAs you can upload a list of search terms such as:

  • Entrez Gene IDs (e.g., 100)
  • Gene symbols (e.g., ADA)
  • RefSeq IDs (e.g., NM_000022)
  • Catalog numbers (e.g., SI00000203)
  • siRNA names (e.g., Hs_ADA_1)
FAQ-1365
I have a Human Druggable Genome siRNA Set V2.0. Can I reorder the siRNAs from this set?

We have updated GeneGlobe and have exchanged several siRNAs with new designs. To find and order siRNAs from your set in GeneGlobe, search by using the siRNA catalog number (e.g., SI00000203). If you search by entering the gene name or accession number, only the new siRNA designs will be shown.

 

FAQ-1366
Can HP Validated siRNAs be ordered on the FlexiPlate?

Yes, you can order HP GenomeWide siRNAs and HP Validated siRNAs with the Flexiplate siRNA format. There is no price difference between HP GenomeWide siRNAs and HP Validated siRNAs ordered as FlexiPlate siRNA. For HP Validated siRNAs, no sequence information is provided.

 

FAQ-1367
Which controls can I choose for FlexiPlate siRNA?

You can add the following controls to your FlexiPlate siRNA plate: AllStars Negative Control siRNA, AllStars Cell Death Control siRNA, Negative Control siRNA, Human GAPDH siRNA, Human Beta-Actin siRNA, Human and mouse MAPK1 siRNA, Human or mouse Lamin A/C siRNA, Mouse AKT1 siRNA, or other siRNAs from GeneGlobe, such as HP Validated siRNAs.

FAQ-1368
Can I order Alexa Fluor labeled controls with FlexiPlate siRNA?

Labeled siRNAs must be ordered separately. They cannot be provided on the same plate with FlexiPlate siRNA.

 

FAQ-1369
If I cannot order FlexiPlate siRNA online, how do I order?

You can search for FlexiPlate siRNAs and design your plate layout online and then download it to an Excel file. Send the Excel file or the ID number of the Excel file to QIAGEN by fax or e-mail. Please also send the Word Flexiplate siRNA Order Form which includes shipping and billing information. Find out more about how to order if you cannot order online.

 

FAQ-1371
Can FlexiPlate siRNAs be ordered in plates other than the standard NUNC 96 well V bottom plates?

We do not provide FlexiPlate siRNAs in customer-specific plates for single plate orders. For large orders, there is the possibility to switch to other plates. Please inquire for details by contacting QIAGEN Technical Service.

 

FAQ-1458
Which kind of 96 and 384-well plates are available for FlexiPlate siRNAs?

FlexiPlate siRNAs will be supplied in NUNC Polystyrene V bottom plates.  NUNC Polystyrene plates can be ordered from Thermo Scientific Company.

  • Nunc MicroWell* 96-Well Microplates catalog # 249940.
  • Nunc* 384-Well Polystyrene Plates catalog # 265203.

http://www.thermoscientific.com/ecomm/servlet/home?storeId=11152&langId=-1

 

Other plates like ABgene AbGene Polypropylene plates can be used but ONLY upon request

FAQ-1459
What information is required to reorder specific siRNAs from a siRNA Set in FlexiPlate format?

Individual siRNAs from the QIAGEN HP siRNA Sets can be reordered in FlexiPlate format by entering the corresponding GeneGlobe catalog number (SI number) for the specific siRNA. SI number information for each siRNA is provided on the annotation CD which is included in the shipment of the siRNA Set.

FAQ-1463
What is the minimum number of siRNAs per order? If I order 40 siRNAs, can I get those on 2 plates?

The minimum order number is 36 in 96 well plates or on average 36 siRNAs per plate. The minimum average number of siRNAs per plate is 36. Thus, with 40 siRNAs, you would receive the siRNAs on one plate. For 72 siRNAs, you can split the siRNAs on 2 plates with 36 siRNA on each plate. If you order 150 siRNAs, you can for example get 3 plates with 50 siRNAs each.

 

To summarize: The minimum number of siRNAs for each catalog Number (or siRNA Sacle -1 nmol, 0.25 nmol or 0.1 nmol) is 36. Within a specific scale, plate can have less than 36 siRNAs, if the minimum average number of siRNAs per plate is 36 siRNAs.

FAQ-1468
Can different amounts of siRNA be ordered on one FlexiPlate?

Only one scale of siRNAs is available per FlexiPlate. If different scales are required, siRNAs have to be ordered on separate FlexiPlates. When ordering different scales on different plates, note that the average number of siRNAs per plate has to be a minimum of 36.

Please see FAQ 1370 for an example and further details.

FAQ-1473
Can FlexiPlate siRNA be ordered in solution on dry-ice?

We strongly recommend our standard method of shipment for FlexiPlate siRNAs in lyophilized form at room temperature. Delivery in solution on dry ice is possible as an exception only and has to be requested specifically when placing the order.

FAQ-1474
Are FlexiPlate siRNAs available at a higher final concentration than 10 µM?

We cannot provide FlexiPlate siRNAs at a higher final concentration. To obtain more concentrated siRNA solutions, individual lyophilized siRNAs can be resuspended in smaller amounts of sterile RNase-Free water. See FAQ 1360 for additional details on recommended resuspension volumes for various scales of FlexiPlate siRNA.

FAQ-1476
If FlexiPlate siRNA was accidentally redissolved in siRNA Suspension Buffer instead of water, resulting in a 2x buffer, would it affect performance of the siRNAs?

We do not expect a difference in performance of the siRNAs in case FlexiPlate siRNA was accidentally redissolved in siRNA Suspension Buffer. However, we have not tested this and do not have any proof data.

 

FAQ-1477
What are the turnaround times for FlexiPlate siRNA orders?

The standard turnaround time for FlexiPlate siRNA orders is 20 working days. Turnaround times for special orders requiring pooling or aliquoting will differ and will be communicated to the end user upon ordering.

 

FAQ-1478
Can I still reorder siRNA that has been removed from the GeneGlobe data base?

Some siRNAs have been deleted from our standard GeneGlobe offering. For those siRNAs, the entries in public databases may have changed and the transcript is no longer listed in those databases. In other cases, we have added siRNAs with a new design.

You can still find previously listed siRNAs in GeneGlobe by searching for the specific SI number (ordering number). See also FAQ 1366 on this topic.

 

FAQ-1668
How to upload a Flexiplate on QIAGEN Webpage?

From the home page go to>Products>Genes & Pathways>Plate Designer. Alternatively, Click on this link Upload an Excel File

Ordering FlexiPlate siRNA
Use this form to order FlexiPlate siRNA.
  Order Form for FlexiPlate siRNA

Along with the Word Order Form, you must also send plate layout information. If you have configured your plates on our Website, download the plate data and send it with the Order Form. Alternatively, you can use the Excel template below to create your own spreadsheet. For help filling in the template, see our detailed siRNA plate template instructions.

You can also use this template to create your own file for uploading to our Website, where you can configure and order your plates online.


*     Excel Template (CSV version)

FAQ-3103
What is the standard format for Flexiplate siRNAs delivery?

Flexiplate siRNAs are delivered annealed and lyophilized.  Each plate  is accompanied by an instruction sheet detailing how to reconstitute the siRNAs in the appropriate volume of RNase-free water, as well as a CD containing the siRNAs IDs, sequences information and gene annotations. See FAQ 1363.

FAQ-3104
How many transfections can be performed with Flexiplate siRNAs?

0.1 nmol scale – add 10 ul of 10uM stock solution.

120 transfections in 96 well plates at 5 nM final concentration OR

60 transfections at 10nM final concentration.

 

0.25 nmol scale - add 25 ul of 10uM stock solution.

300 transfections in 96 well plates at 5 nM final concentration OR 

150 transfections at 10nM final concentration.

 

1.0 nmol scale - add 50 ul of 20uM stock solution.

1200 transfections in 96 well plates at 5 nM final concentration OR 

 600 transfections at 10nM final concentration.

FAQ-3105
How do I submit a siRNA order by telephone or online?

FlexiTube siRNA, FlexiTube GeneSolution, FlexiTube siRNA Premix, FlexiPlate siRNA, and GeneFamily Lists siRNAs can be ordered by catalog number over the telephone.

However, to ensure accuracy, Custom siRNA Synthesis orders should be submitted in writing. Therefore you can use the HP Custom siRNA Order Form https://www.qiagen.com/products/genesilencing/customsirna/customsirnaorder.aspx?EmailOrdering=1.

Visit the RNAi Solutions page http://www.qiagen.com/products/rnai/default.aspx?r=2714 on our homepage for access to the Online Ordering Tool, and choose the order link for your product of interest.

FAQ-399
Has RNAi been successful using siRNA in Zebrafish and Xenopus?

Here are examples of references that describe the inhibition of gene expression by siRNA in Xenopus and Zebrafish:

FAQ-400
What are the sequences of the FlexiTube siRNAs?

You will receive the sequences of the FlexiTube siRNAs on the data sheet along with your order.

A graphic representation of the position of HP GenomeWide siRNAs along the target sequence is available for numerous genes on our website. It can be accessed via GeneGlobe after pulling up the target gene of interest, clicking on the 'Gene Symbol' link for the species of interest, and then clicking the link under 'Product name' for details on the gene product of interest.



FAQ-851