The Antisense LNA GapmeR design tool is partly empirically derived and incorporates more than 20 years of experience with LNA design. For each RNA target, the tool evaluates thousands of possible LNA GapmeR designs against more than 30 design parameters and identifies the LNA GapmeRs most likely to give potent and specific target knockdown.

The primary design parameters are:

• Optimal target sequence accessibility: Ensures high potency. The design tool selects target sequences based on local secondary structure prediction.
• Antisense off-target evaluation: Sequence alignments in ENSEMBL improve selection of LNA GapmeRs with minimal off-targets in the spliced and unspliced transcriptomes.
• Optimal oligonucleotide design: Length, Tm, gap size, self-complementarity, LNA positions, etc. are all optimized.

• Length of target: The minimum input is 200 nucleotides. If your target is < 200 nucleotides, please contact our technical support for assistance.
• Length of design region: The minimum design region is 15 nucleotides corresponding to the length of an LNA GapmeR (15–16mer).

1. Choose a name for your LNA GapmeRs
   
   This name will appear on the labels of your LNA GapmeR tubes and will be used in your design history. If you are running several designs in parallel, these names will help you keep track of the different design jobs.
   
   
2. Select species
   
   Selection of species is a crucial part of LNA GapmeR design, since the specificity of a GapmeR is a function of the transcriptome environment in which it is used. It is currently possible to design LNA GapmeRs for human, mouse and rat RNA targets. We are working on making more organisms available. If you wish to design LNA GapmeRs for organisms other than human, mouse or rat, please contact our technical support.
   
   
3. Define your RNA target by one of the following methods
   
   - Define your target RNA by sequence ID (GenBank, RefSeq, Ensembl or keyword, such as GAPDH
   - Enter your sequence by pasting it directly into the designated field
   - Upload a file containing your sequence
   
   Note: For your assurance and complete control of the input RNA sequence, we recommend that you look up the latest version of your target transcript in the databases or from your own sequencing data and enter it manually in the design tool.
   
   Enter the sequence in FASTA format. If you enter information about the sequence (gene name, gene or transcript accession number in red below) correctly in FASTA format, it will appear as "Target ID" in the LNA GapmeR design results pages. If you don't enter this information, your target will appear as "Custom target".
   
   Example of target RNA sequence entered correctly in FASTA format:
   >ENST00000350051-Survivin
   CAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATT
   TGAATCGCGGGACCCGTTGGCAGAGGTGGCGGCGGCGGCATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGC…
   
   
4. Design LNA GapmeRs with the default settings
   
   In most cases, once you have entered your sequence, you are ready to initiate the design process by pressing the "Next" button.
   
   
5. Design LNA GapmeRs with special settings
   
   Primary transcripts as input sequence: If you enter an unspliced RNA sequence, tick the "primary transcript" box. This information is only required for optimal design of LNA qPCR validation assays.
   
   Novel RNA sequence: If your RNA is novel and is not yet in the Ensembl database, it is important for the proper design of your LNA GapmeRs that you inform us about this by using the designated checkbox. In case you are in doubt, please perform an appropriate Blastn search in Ensembl.
   
   Define design region: Use the designated checkbox to define the design region. This will enable you to specify the region of the target RNA to which the LNA GapmeRs will be designed. An LNA GapmeR will in most cases provoke degradation of the entire RNA target, regardless of the location of the target site. However, in some cases, it does make sense to confine the LNA GapmeR design to a specific region of the target RNA.
   
   Note: The number and quality of generated LNA GapmeRs is correlated with the length of input sequence and design region. A short input sequence or design region <1000 nucleotides is likely to result in few or no LNA GapmeRs that pass our threshold design score criteria. To optimize your chances of excellent GapmeR quality (potency and specificity), we strongly recommend that you maximize the sequence input and design region.
   
   Press the "Next" button to launch the LNA GapmeR design.
   
   
6. Select your target
   
   If you defined your target by sequence ID, you will be taken to a new page. This page displays the results of a lookup in our database Ensembl (77: Oct 2014) to identify your RNA. Select the transcript of interest that you would like the tool to use for the design of your LNA GapmeRs. If none of the proposed transcripts correspond exactly to your target, then look up the sequence in your database and enter it manually into the designated field.
   
   Many genes give rise to multiple transcripts due to alternative splicing events or alternative transcription start sites. If you wish to perform selective knockdown of only one transcript variant, you may do this by restricting the design region to a sequence unique to the transcript variant in question. GapmeRs have the potential to cause degradation of primary RNA transcripts prior to splicing.
   
   Press "Next" to launch the LNA GapmeR design.

On the results page, you will find a table listing a maximum of 10 LNA GapmeRs that passed our design score criteria. The table contains information regarding rank, design score and additional details about each LNA GapmeR.

Rank and design score

The LNA GapmeRs are ranked according to their design score (rank 1 = best design score). Statistically, we see a correlation between design score and LNA GapmeR performance. The design score is a composite of multiple factors, such physical oligonucleotide properties and predictions of target accessibility and number of potential off-targets.

We distinguish LNA GapmeRs with "excellent design score" and "dood design score". "Excellent design score" means that the LNA GapmeR scores highly on all design parameters. "Good design score" means that the LNA GapmeR scores highly on most design parameters but may not score as well on one of the design features. In many cases, this will not have any effect on the KD efficacy, but the specificity may be compromised.

Note: We recommend that you choose GapmeRs based on rank, rather than considerations about position of the target site. This is particularly true for short sequence inputs < 2000 nucleotides.

Additional design details

By expanding the "Details" column, you can find additional information about your LNA GapmeR designs (see figure XXX). We recommend that you spend a few minutes to review these details to ensure that the design job was performed according to your wishes.

Target ID: If you entered a name for your target RNA sequence correctly in FASTA format, it will appear here.

Species: Your choice of species will appear here. We strongly recommend that you check that you chose the right species for your LNA GapmeR design, since this is crucial to the design of LNA GapmeRs with optimal target specificity.

Transcript variants: The Ensembl ID of the gene encoding your target RNA as well as IDs for all transcripts deriving from this gene that share the target site of the LNA GapmeR are displayed here.

When you submit a sequence for LNA GapmeR design, our design tool will perform a Blastn search in Ensembl (77: Oct 2014) to identify the gene encoding your RNA. We recommend that you verify that the gene identified corresponds with your sequence information.

Note that many genes give rise to multiple transcripts due to alternative splicing events or alternative transcription start and stop sites. Transcript variants listed in Ensembl deriving from your gene are not considered as off-targets by our design tool, but if they share the LNA GapmeR target site, they will be indicated in this list of transcript variant targets. GapmeRs have the potential to cause degradation of primary RNA transcripts prior to splicing.

LNA GapmeR target site: We only provide information about the LNA GapmeR sequence upon purchase. However, to help guide your choice of LNA GapmeRs, we do indicate the position of the LNA GapmeR target sites on a simple graphic representation of your RNA target (see figure xxx). If you specified a design region, this will also be indicated on the figure.

You will need to observe the same phenotype with at least two different LNA GapmeRs to verify that the effect is due to knockdown of your target RNA. Screening of 5 LNA GapmeRs will typically identify 2–3 LNA GapmeRs that give potent knockdown of your target RNA.

To select an LNA GapmeR for ordering, you need to first specify the quality grade and the yield you desire (and label if relevant), before it can be added to the shopping basket. Your selection will then appear above the results table. Once you have specified the quantity of each item, click "Next" to proceed with selection of optional controls and direct web ordering.

Quality grades available:

• Antisense LNA GapmeR Standard: Cost-effective alternative for initial screening of multiple designs using standard cell-lines. Available with PS backbone and standard desalted purification. Choice of 5 nmol and 15 nmol yields. Also available with 5’ or 3’ fluorescent labels.
• Antisense LNA GapmeR Premium: HPLC-purified LNA GapmeRs with guaranteed purity suitable for most cell assays. Available with PS backbone and HPLC purification. Choice of 5 nmol and 15 nmol yields. Also available with 5’ or 3’ fluorescent labels.
• Antisense LNA GapmeR in vivo Ready: Highly purified LNA GapmeRs recommended for in vitro experiments that require the use of high concentrations (µM) of LNA GapmeR. This is required for delivery of the LNA GapmeR by unassisted uptake(gymnosis), without the aid of transfection reagents. Available with PS backbone and HPLC Na+ purification. Choice of 5 nmol or 15 nmol yields. Also available with 5’ or 3’ fluorescent labels.
• Antisense LNA GapmeR in vivo Large Scale: LNA GapmeRs are also available with custom large-scale synthesis yields for in vivo experiments. Please contact us for more information.

Proper controls are an essential part of any RNA silencing experiment. Controls shall appear under a configured design. Click on one of the selected controls to trigger a configurator that allows you to select one of the available product variants and add it to the shopping cart.

We recommend the following controls:

• A validated positive control LNA GapmeR: QIAGEN’s validated positive control Antisense LNA GapmeRs and corresponding qPCR control primer sets help optimize delivery conditions.

• A negative control LNA GapmeR: One of our negative control Antisense LNA GapmeRs can be used to confirm that phenotypes obtained with your GapmeRs is not simply the result of a general response to LNA oligonucleotides. An untreated control is also useful to evaluate effects of transfection.

Selected control LNA GapmeRs will be added to your shopping cart, where you can change the quantities.

Note: Observing the same phenotype with two (or more) different GapmeRs is a powerful way of ascertaining that the phenotype is due to knockdown of the intended target.

My LNA GapmeR design job returned < 5 LNA GapmeR designs. Why?
My LNA GapmeRs are all confined to a specific region of my RNA. Why?
My LNA GapmeR design job returned few or no LNA GapmeRs with "Excellent design score". Why?

There can be several reasons for these outcomes:

• Your RNA target is short (less than ~500–1000 nucleotides)
  Short RNAs can be highly challenging for our design tool, because they are more likely to feature no or few LNA GapmeR target sites that are both accessible and specific to your RNA. If you have not already done so, we recommend that you paste the full sequence of your target RNA into the design tool. If you still experience difficulties, please contact our technical support.

• The defined design region is short
  The number and quality of generated LNA GapmeRs is correlated with the length of the design region. Definition of a short design region will likely result in few or no LNA GapmeRs that pass our threshold design score criteria. We recommend that you try to launch another design with an expanded design region, preferably >1000 nucleotides.

• There are many transcripts with very high homology to your RNA sequence
  In rare cases, our LNA GapmeR design is unsuccessful due to issues of specificity. This happens if there are many genes in the Ensembl database that give rise to transcripts with very high homology to your RNA target. Because of the high number of unavoidable off-targets, the design score drops below the threshold value. An example of this is GAPDH mRNA in mouse. There are multiple pseudogenes and other ncRNAs that have sequences almost identical to GAPDH across almost the entire length of the RNA. You can check if this is the case for your RNA target by performing a Blastn analysis in Ensembl.
  In rare cases, certain RNA sequences are predicted to be engaged in strong secondary structures with very few sites accessible to hybridization with LNA GapmeRs.

 

How do I design LNA GapmeRs that selectively target a specific transcript variant?
This is possible if your transcript variant contains unique sequence. In this case, use the option to define the design region to force the tool to select LNA GapmeRs that target the unique part of the sequence only. However, note that GapmeRs have the potential to cause degradation of primary RNA transcripts prior to splicing. It is therefore important that the effects on all relevant splice variants are carefully studied using custom-designed LNA qPCR assays or other appropriate methods to ascertain if the knockdown is specific for the desired splice variant.

Note: The number and quality of generated LNA GapmeRs correlate with the length of the design region. Defining a short design region is likely to result in few or no LNA GapmeRs that pass our threshold design score criteria.

I would like to evaluate your LNA GapmeR design before ordering, but I don’t find information about the LNA GapmeR sequence?
We have invested significant resources and efforts into the development of our proprietary LNA GapmeR design tool. Our LNA GapmeR designs are optimized to provide potent and specific knockdown of the specified RNA target. The sequence of our LNA GapmeRs is provided in the accompanying datasheets, but only after purchase of the products.