Looking for a quick way to design experiments?
Try the Workflow Configurator. A convenient tool to build experimental workflows and find products to match your needs.
FAQ-1363

What information is provided with FlexiPlate siRNAs?

With FlexiPlate siRNA, you receive a CD with an Excel file that contains the following information (example):

  • Plate ID: 1
  • Row: A
  • Column: 2
  • Entrez Gene ID: 9210
  • NCBI Gene Symbol: BMP15
  • Gene description: bone morphogenetic protein 15
  • siRNA target sequence (for HP GenomeWide siRNAs): TCGGAGTATAAGTATGAATTCCAA
  • RefSeq ID (mRNA accession): NM_00222
  • mRNA location: 756
  • mRNA region: CDS
  • Catalog number SIxxxxxx

 

Can’t find what you are looking for?

Browse the FAQ base with our FAQ search.