Antimicrobial Resistance Research with Experiment Configurator

Enzymes for molecular biology

Explore high-quality enzymes; now available as individual products.

Products and tools for your targets

Explore targets and pathways in their scientific context, find and customize products to study them, analyze data and plan follow-up studies – all in GeneGlobe.

QuantiFERON-TB Gold Plus

Detect TB infection with confidence.

Looking for a quick way to design experiments?
Looking for a quick way to design experiments?
Try the Workflow Configurator. A convenient tool to build experimental workflows and find products to match your needs.
Welcome to My QIAGEN
Dashboard
Account
Orders
Log Out

What is the sequence of the UDI 5' Adapter?

(5’–3') CTACACGACGCTCTTCCGATCT

icon_0011_idea-s

Can’t find what you are looking for?

Browse the FAQ base with our FAQ search.

Search all FAQ
Country and Language
Contact Us
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.
Sample to Insight
© QIAGEN 2013–24. All rights reserved
Trademarks & DisclaimersTerms & ConditionsPrivacyConsent ManagerAccessibilityCancellation and Returns