text.skipToContent text.skipToNavigation

qBiomarker Array PreAMP Mix

For loci-specific preamplification prior to real-time PCR to support ultrasensitive cancer mutation detection
  • Nested preamplification improves sensitivity and decreases false positives
  • PCR-based protocol is accessible to most laboratories
  • Integrated, complimentary data analysis simplifies mutation calling
The qBiomarker Array PreAMP Mix enables preamplification of DNA from small amounts of intact or degraded DNA prior to analysis with qBiomarker Somatic Mutation PCR Arrays. The kit contains a mixture of loci-specific primers which, together with the qBiomarker PreAMP PCR Mastermix, uses multiplex PCR preamplification to amplify loci-specific DNA target templates with minimal bias for analysis with qBiomarker Somatic Mutation PCR Arrays or Assays.
Advanced search settings



Species:
Products
Product Product no. Cat. no. List price:
 
 
Show details
    varies
Can't order online?
To place an order via phone, email or for requesting a quote, please provide the product’s name, number and catalog number.

Principle

For successful somatic mutation detection, experimental methods must detect the DNA molecules with mutations of interest in samples that may contain a vast excess of DNA molecules with the wildtype sequence at the same locus. Based off of this principle, there are two factors that affect these experiments: the inherent percentage of mutant DNA in a sample, and the sensitivity of the method. In the case of cancer, a specific mutation may be found in a small percentage of the tumor, which is a characteristic of tumor heterogeneity. Additionally, different types of samples and sample sources affect this ratio of mutant to wildtype DNA as well as the number of DNA molecules that can be assayed. A method’s sensitivity directly reflects how few mutant DNA molecules can be detected within a given amount of wildtype DNA.

Sample types common in cancer research, including formalin-fixed paraffin embedded (FFPE) samples, serum samples, fine needle biopsies, and sorted cells frequently contain only small amounts of amplifiable DNA. Genomic DNA in FFPE samples is fragmented, for example, while DNA in serum samples is heavily diluted. In the case of fine needle biopsies or sorted cells, these samples have small numbers of cells that will yield limited amounts of genomic DNA. Amplifying genomic DNA enables more accurate detection of the mutations in DNA from these sample types.

The qBiomarker PreAMP system uses nested PCR preamplification to improve specificity and decrease false positives. In a 12-cycle PCR reaction, the loci of interest are amplified and are ready to be analyzed with qBiomarker Somatic Mutation PCR Assays and Arrays. The qBiomarker Array PreAMP Mixes contain primers for loci that correspond to the cataloged qBiomarker Somatic Mutation PCR Arrays. Used in combination with the qBiomarker PreAMP Synthesis Kit, this mix produces amplified products specific for the array to be used.

Procedure
DNA is first isolated from FFPE, serum, or small samples using the appropriate QIAamp or DNeasy kit. The qBiomarker PreAMP Synthesis Kit and qBiomarker Array PreAMP Mix are then used to preamplify the DNA using locus-specific primers. qBiomarker Somatic Mutation Arrays are used for mutation detection, and CT values are uploaded into the GeneGlobe Data Analysis tool for data analysis and mutation calls.
Applications

The qBiomarker Array PreAMP Mix is highly suited for preamplification of genomic DNA from samples with low amounts of amplifiable DNA for exclusive use with qBiomarker Somatic Mutation PCR Arrays. Recommended sample types include:

  • FFPE samples
  • Plasma, serum, urine, or other cell-free body fluids
  • Laser capture microdissection samples
  • Fine needle biopsies
  • FACS-sorted cells

You are not authorized to download the resource

Instrument Technical Documents (1)
For screening disease-focused mutation panels by PCR
Show details
fragment fix placeholder
Name qBiomarker PreAMP for RTK Panel I (SMBH-008A)
Species Human (Homo sapiens)
For use with the following mutations:
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.2237_2255>T
Amino Acid Change p.E746_S752>V
COSMIC ID 12384
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.2429G>A
Amino Acid Change p.G810D
COSMIC ID 12986
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.2156G>A
Amino Acid Change p.G719D
COSMIC ID 18425
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.2497T>G
Amino Acid Change p.L833V
COSMIC ID 13424
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.2126A>C
Amino Acid Change p.E709A
COSMIC ID 13427
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.2193G>A
Amino Acid Change p.W731*
COSMIC ID 13432
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.866C>T
Amino Acid Change p.A289V
COSMIC ID 21687
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.1793G>T
Amino Acid Change p.G598V
COSMIC ID 21690
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.2572C>A
Amino Acid Change p.L858M
COSMIC ID 12366
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.2239_2258>CA
Amino Acid Change p.L747_P753>Q
COSMIC ID 12387
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change c.323G>A
Amino Acid Change p.R108K
COSMIC ID 21683
Gene Symbol ERBB2
RefSeq Accession # NM_004448
Nucleotide Change c.2322_2323insGCATACGTGATG
Amino Acid Change p.M774_A775insAYVM
COSMIC ID 682
Also Detect (12558) c.2325_2326insTACGTGATGGCT, p.A775_G776insYVMA
Gene Symbol ERBB2
RefSeq Accession # NM_004448
Nucleotide Change c.2305G>C
Amino Acid Change p.D769H
COSMIC ID 13170
Gene Symbol ERBB2
RefSeq Accession # NM_004448
Nucleotide Change c.2340_2341insGGCTCCCCA
Amino Acid Change p.P780_Y781insGSP
COSMIC ID 12556
Also Detect (26681) c.2333_2334insGGG, p.G778_S779insG
Gene Symbol ERBB2
RefSeq Accession # NM_004448
Nucleotide Change c.2330T>C
Amino Acid Change p.V777A
COSMIC ID 35496
Gene Symbol FGFR2
RefSeq Accession # NM_000141.2
Nucleotide Change c.755C>G
Amino Acid Change p.S252W
COSMIC ID 36903
Gene Symbol FGFR2
RefSeq Accession # NM_000141.2
Nucleotide Change c.1647T>G
Amino Acid Change p.N549K
COSMIC ID 36902
Gene Symbol FGFR3
RefSeq Accession # NM_000142
Nucleotide Change c.742C>T
Amino Acid Change p.R248C
COSMIC ID 714
Gene Symbol FGFR3
RefSeq Accession # NM_000142
Nucleotide Change c.1138G>A
Amino Acid Change p.G380R
COSMIC ID 24842
Gene Symbol FGFR3
RefSeq Accession # NM_000142
Nucleotide Change c.2089G>T
Amino Acid Change p.G697C
COSMIC ID 24802
Gene Symbol FGFR3
RefSeq Accession # NM_000142
Nucleotide Change c.1949A>C
Amino Acid Change p.K650T
COSMIC ID 731
Gene Symbol FLT3
RefSeq Accession # Z26652
Nucleotide Change c.2492G>A
Amino Acid Change p.G831E
COSMIC ID 25248
Gene Symbol FLT3
RefSeq Accession # Z26652
Nucleotide Change c.2501G>A
Amino Acid Change p.R834Q
COSMIC ID 28047
Gene Symbol FLT3
RefSeq Accession # Z26652
Nucleotide Change c.2525A>G
Amino Acid Change p.Y842C
COSMIC ID 19692
Gene Symbol FLT3
RefSeq Accession # Z26652
Nucleotide Change c.1803_1804insCAGCTACAGATGGTACAGGTGACCGG
CTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAA
TATGAATATGATCTC
Amino Acid Change p.L601_K602ins27
COSMIC ID 19737
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1679T>A
Amino Acid Change p.V560D
COSMIC ID 1257
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.2474T>C
Amino Acid Change p.V825A
COSMIC ID 1323
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1727T>C
Amino Acid Change p.L576P
COSMIC ID 1290
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1924A>G
Amino Acid Change p.K642E
COSMIC ID 1304
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1509_1510insGCCTAT
Amino Acid Change p.Y503_F504insAY
COSMIC ID 1326
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1961T>C
Amino Acid Change p.V654A
COSMIC ID 12706
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1735_1737delGAT
Amino Acid Change p.D579del
COSMIC ID 1294
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1656_1673del18
Amino Acid Change p.Y553_K558>
COSMIC ID 27909
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.2467T>G
Amino Acid Change p.Y823D
COSMIC ID 18681
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1621A>C
Amino Acid Change p.M541L
COSMIC ID 28026
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.2009C>T
Amino Acid Change p.T670I
COSMIC ID 12708
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.2460T>A
Amino Acid Change p.D820E
COSMIC ID 12709
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.1673_1687del15
Amino Acid Change p.K558_E562del
COSMIC ID 18896
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.154G>A
Amino Acid Change p.D52N
COSMIC ID 1146
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change c.2143_2145delAGC
Amino Acid Change p.S715del
COSMIC ID 1306
Gene Symbol MET
RefSeq Accession # NM_000245
Nucleotide Change c.2942_3082del141
Amino Acid Change p.L982_D1028del
COSMIC ID 29632
Gene Symbol MET
RefSeq Accession # NM_000245
Nucleotide Change c.3803T>C
Amino Acid Change p.M1268T
COSMIC ID 691
Gene Symbol MET
RefSeq Accession # NM_000245
Nucleotide Change c.3029C>T
Amino Acid Change p.T1010I
COSMIC ID 707
Gene Symbol MET
RefSeq Accession # NM_000245
Nucleotide Change c.3757T>G
Amino Acid Change p.Y1253D
COSMIC ID 700
Gene Symbol MET
RefSeq Accession # NM_000245
Nucleotide Change c.2962C>T
Amino Acid Change p.R988C
COSMIC ID 705
Gene Symbol PDGFRA
RefSeq Accession # NM_006206
Nucleotide Change c.1975A>T
Amino Acid Change p.N659Y
COSMIC ID 22416
Gene Symbol PDGFRA
RefSeq Accession # NM_006206
Nucleotide Change c.2021C>T
Amino Acid Change p.T674I
COSMIC ID 743
Gene Symbol PDGFRA
RefSeq Accession # NM_006206
Nucleotide Change c.1694_1695insA
Amino Acid Change p.S566fs*6
COSMIC ID 28053
Gene Symbol PDGFRA
RefSeq Accession # NM_006206
Nucleotide Change c.2525_2538>GA
Amino Acid Change p.D842_D846>G
COSMIC ID 12412
Gene Symbol PDGFRA
RefSeq Accession # NM_006206
Nucleotide Change c.2526_2541>GGCC
Amino Acid Change p.D842_S847>EA
COSMIC ID 12415
Gene Symbol PDGFRA
RefSeq Accession # NM_006206
Nucleotide Change c.2485G>A
Amino Acid Change p.G829R
COSMIC ID 13348
Gene Symbol EGFR
RefSeq Accession # NM_005228
Nucleotide Change copy number
Amino Acid Change copy number
Gene Symbol PDGFRA
RefSeq Accession # NM_006206
Nucleotide Change copy number
Amino Acid Change copy number
Gene Symbol FLT3
RefSeq Accession # Z26652
Nucleotide Change copy number
Amino Acid Change copy number
Gene Symbol ERBB2
RefSeq Accession # NM_004448
Nucleotide Change copy number
Amino Acid Change copy number
Gene Symbol FGFR2
RefSeq Accession # NM_000141.2
Nucleotide Change copy number
Amino Acid Change copy number
Gene Symbol FGFR3
RefSeq Accession # NM_000142
Nucleotide Change copy number
Amino Acid Change copy number
Gene Symbol KIT
RefSeq Accession # NM_000222
Nucleotide Change copy number
Amino Acid Change copy number
Gene Symbol MET
RefSeq Accession # NM_000245
Nucleotide Change copy number
Amino Acid Change copy number