Mm/Hs_MAPK1 Control siRNA

For a positive control knockdown in siRNA experiments

Features

 

Mm/Hs_MAPK1 control siRNA (5 nmol)

Cat. No. / ID: 1022564

Mm/Hs_MAPK1 control siRNA (5 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
Amount
5 nmol
20 nmol
The Mm/Hs_MAPK1 Control siRNA is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.

Product Details

siRNA control for human or mouse mitogen-activated protein kinase-1.

Principle

Mm/Hs_MAPK1 control siRNA product details
siRNA type Control
Sense sequence UGCUGACUCCAAAGCUCUGdTdT
Antisense sequence CAGAGCUUUGGAGUCAGCAdTdT
Target DNA sequence AATGCTGACTCCAAAGCTCTG
Dye label/detection                     –

FAQ

Can the MAPK1 siRNA of the RNAi Human/Mouse Starter Kit be purchased separately?

Yes, the MAPK1 siRNA of the RNAi Human/Mouse Starter Kit can be ordered separately. It is one of our Control siRNAs. Our website has the ordering and sequence information for the Mm/Hs_MAPK1 control siRNA (5 nmol) supplied in the kit.

FAQ ID -744
Do you have an antibody for Western Blot Analysis of MAPK1 gene knockdown using your MAPK1 control siRNA?

Yes. The Human and Mouse MAPK1 protein (also called MAPK2 or Erk2, GenBank accession numbers NM_002745 [human] and NM_011949 [mouse]) can be easily detected by western blotting using the MAPK1-specific Tag-100 Antibody. The Tag-100 Antibody was originally developed for detection of proteins expressed using QIAGEN’s pQE-100 DoubleTag Vector. It is also effective for monitoring gene silencing of human and mouse MAPK1 at the protein level since the Tag-100 epitope that it detects is derived from MAP Kinase.

Hs/Mm_MAPK1 control siRNA is one of QIAGEN's Control siRNAs, and is also included as a positive control in the RNAi Human/Mouse Starter Kit.

FAQ ID -746
Which siRNA controls are available in FlexiTube format?
siRNA Controls available in FlexiTube format are:

Mm/Hs_MAPK1 control siRNA (5 nmol)    cat. no. 1022564

GFP-22 siRNA (5 nmol)    1022064

Luciferase GL2 siRNA (5 nmol)     1022070

Luciferase GL3 siRNA (5 nmol)     1022073

Negative Control siRNA (5 nmol)      1022076

AllStars Negative Control siRNA (5 nmol)     1027280

AllStars Neg. Control siRNA (20 nmol)        1027281

AllStars Neg. siRNA AF 488 (5 nmol)         1027284

AllStars Neg. siRNA AF 546 (5 nmol)         1027285

AllStars Neg. siRNA AF 555 (5 nmol)         1027286

AllStars Neg. siRNA AF 647 (5 nmol)          1027287

AllStars Neg. siRNA AF 488 (20 nmol)         1027292

AllStars Neg. siRNA AF 546 (20 nmol)          1027293

AllStars Neg. siRNA AF 555 (20 nmol)          1027294
 
AllStars Neg. siRNA AF 647 (20 nmol)          1027295

AllStars Hs Cell Death Control siRNA (5 nmol)     1027298

AllStars Hs Cell Death Control siRNA  (20 nmol)    1027299

Negative Control siRNA (20 nmol)                 1027310

Mm/Hs_MAPK1 control siRNA (20 nmol)          1027321







FAQ ID -1661
Can the MAPK1 control siRNA be used for rat cells?
No. The Mm/Hs_MAPK1 control siRNA is specific for mouse and human MAPK1 only. Please visit GeneGlobe to search for all currently available gene-specific products for RNAi.
FAQ ID -547