Looking for a quick way to design experiments?
Try the Workflow Configurator. A convenient tool to build experimental workflows and find products to match your needs.

QIAseq miRNA Library Kit

Gel-free miRNA Sample to Insight solution for differential expression analysis and novel discovery using next-generation sequencing

Want to try this solution for the first time?
Get in touch with our team today and request a quote to trial the QIAseq miRNA Library Kit (12).

QIAseq miRNA Library Kit (12)

Cat no. / ID.   331502

For 12 sequencing prep reactions: 3’ ligation, 5’ ligation, reverse-transcription, cDNA cleanup, library amplification and library cleanup reagents; quality control primers
Log in To see your account pricing.
KitIndex
Library Kit
miRNA Index Kit Version 1
miRNA Index Kit UDI Version 2
Reactions
12
96
The QIAseq miRNA Library Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.
Want to try this solution for the first time?
Get in touch with our team today and request a quote to trial the QIAseq miRNA Library Kit (12).

Features

  • Gel-free miRNA sequencing library prep speeds up library construction time
  • Elimination of adapter dimers and hY4 RNA resulting in the highest fidelity and most efficient data from low input serum, plasma and exosome samples
  • Integrated Unique Molecular Indices (UMIs) enable quantification of individual miRNA molecules
  • Includes access to the RNA-seq Analysis Portal for human, mouse and rat samples
  • Available with 768 unique dual indices for high-throughput sequencing on Illumina NovaSeq instruments

Product Details

Optimized reaction chemistry enables robust, miRNA-specific libraries while minimizing reaction biases and eliminating adapter dimers. Unique Molecular Indices (UMIs) tag each miRNA at an early stage, eliminating PCR and sequencing bias. Analyze miRNA-seq data with ease using the GeneGlobe-integrated RNA-seq Analysis Portal – an intuitive, web-based data analysis solution created for biologists and included with QIAseq Stranded RNA Library Kits.

High-throughput sequencing on Illumina NovaSeq instruments is now possible with 768 unique dual indices.

Important note: We highly recommend that data is only compared with RNA-seq libraries that use the same type of indices (single or unique dual indices) in order to ensure experimental consistency. Samples and data generated with single-end indexed libraries should only be compared with other samples and data generated with single-end indices. Samples and data generated with unique dual indices should only be compared to other samples and data generated with unique dual indices.

Performance

QIAseq miRNA sequencing enables superior data generation through an improved workflow. The standard QIAseq miRNA procedure does not require gel purification, excision and elution, providing substantial sample handling/loss and time savings.
A huge issue with miRNA sequencing workflows is the presence of adapter dimer contamination. The QIAseq miRNA Library Kit has fully optimized library process to virtually eliminate adapter dimerization, even from very low inputs of total RNA (see figure Adapter dimers (AD) and contaminating RNA steal your reads during miRNAseq experiments). In addition, the reaction chemistry facilitates the preparation of robust, miRNA-focused libraries while all but eliminating biases and background contaminants. Together, these benefits highlight that the QIAseq miRNA Library Kit is designed to maximize the yield of miRNA available to sequence.
Due to the growth of circulating miRNAs as potential biomarkers, the QIAseq miRNA Library Kit is optimized to map miRNA down to ultralow input levels. In addition, the kit integrates Unique Molecular Indices (UMIs) into the reverse-transcription process, enabling unbiased and accurate miRNome-wide quantification of mature miRNAs by NGS. Collectively, QIAseq miRNA offers an unrivaled Sample to Insight solution for differential expression analysis and discovery of novel miRNAs using next-generation sequencing (see figure QIAseq miRNA workflow).

Principle

Mature miRNAs are naturally occurring, 22-nucleotide, non-coding RNAs that mediate posttranscriptional gene regulation. Alterations in miRNA can be correlated with gene expression changes in development, differentiation, signal transduction, infection, aging and disease. Continually growing evidence associates circulating miRNA expression with both normal and disease biology as miRNAs expressed in virtually all biofluids, including serum, plasma, cerebrospinal fluid (CSF) and urine. Specifically with cancers, numerous studies and reviews have associated the presence of various miRNAs with cancer cell proliferation, resistance to apoptosis, invasiveness and differentiation.

Quantification of miRNA expression can be performed using a variety of technologies including next-generation sequencing (NGS) and real-time PCR (qPCR). While NGS is the default tool for novel miRNA discovery, commercially available library preparation kits are tedious and introduce biases. As a result, qPCR has been the “go to” technology for quantification of miRNA expression, until now. QIAseq miRNA defines a new generation in small RNA sequencing products and includes several distinct features not found in other sequencing kits. With the QIAseq miRNA Library Kit, the power of NGS has been combined with single molecule quantification from UMIs to produce the most representative expression data possible.

Procedure

QIAGEN offers a true Sample to Insight workflow, from sample isolation to data analysis and interpretation. Total RNA is first extracted from biofluids (such as serum, plasma, CSF and urine), cells, fresh/frozen tissues or FFPE tissues using a miRNeasy kit. From there, miRNA sequencing libraries are prepared using the QIAseq miRNA Library Kit (see figure Under a day prep).
In an unbiased reaction, adapters are ligated sequentially to the 3’ and 5’ ends of miRNAs. Subsequently, universal cDNA synthesis with UMI assignment, cDNA cleanup, library amplification and library cleanup are performed. Proprietary methodology, using modified oligonucleotides, virtually eliminates the presence of adapter dimers in the sequencing library and effectively removes a major contaminant often observed during sequencing. Bead-based cleanups eliminate the majority of unwanted background noise that steals sequencing reads from a budget. The UMIs ensure that during data analysis, the sample is analyzed specifically, not amplification or sequencing artifacts. To go from sample to sequencer, the process takes only eight hours, with minimal hands-on time. Up to a maximum of 48 samples can be multiplexed.

After sequencing, “.fastq” or “.fastq.gz” file formats can be uploaded directly to the GeneGlobe Data Analysis Center for primary mapping and molecular tag counting. For well-characterized species, such as human, mouse and rat, reads are mapped to species-specific miRBase and genome databases. For poorly-characterized or novel species, read are mapped to the entire miRBase database. Secondary differential expression analysis is then performed with multiple methods for molecular tag count normalization and visualization of the resulting data.

Applications

Biofluids (such as serum, plasma, CSF and urine), cells, fresh/frozen tissue and FFPE tissues containing total and miRNA are compatible with the QIAseq miRNA Library Kit. Use the QIAseq miRNA Library Kit to characterize the next circulating miRNA biomarker. Uncover miRNA signatures locked away in FFPE tissues. Completely characterize a new species. The QIAseq miRNA Library Kit has been designed to enhance yields from biofluids such as serum. In the figure Detection of miRNA, the QIAseq miRNA Library Kit shows robust detection of miRNA from serum samples. Mapped reads were then compared to adapter dimers in serum samples. QIAseq miRNA still shows superior mapping of miRNAs even with limited samples (see figure Read distribution in serum samples). With the QIAseq miRNA Library Kit, determine the differential expression of any known or novel miRNAs from any total RNA sample derived from any species.

QIAseq miRNA is the ultimate tool to enhance discovery and expression from large-scale projects with hundreds of samples down to the small pilot focused on a group of target miRNA. QIAseq miRNA offers an unrivaled Sample to Insight solution for differential expression analysis and discovery of novel miRNAs using next-generation sequencing.

Supporting data and figures

Resources

Brochures & Guides (2)
Kit Handbooks & Protocols (7)
For use with QIAseq miRNA Library Auto Kit (384) (331509) and QIAseq miRNA 96 Index IL Auto A (331567, 331569)
For use with QIAseq miRNA library kits (331502, 331505) and QIAseq miRNA Index TF Kits (331582, 331585)
For use with QIAseq miRNA library kits (331502, 331505) and QIAseq miRNA Index IL Kits (331592, 331595, 331565)
For use with QIAseq miRNA library kits (331502, 331505) and Singular Genomics UDI Primer kit
Part 1: 3' Ligation, 5' ligation, reverse transcription
Part 2: QIAseq miRNA NGS (QMN) Bead preparation, cDNA cleanup
For use with QIAseq miRNA library kits (331502, 331505) and QIAseq miRNA Index Kits UDI (331601, 331615, 331625, 331635, 331645, 331655, 331665, 331675, 331685, 331905, 331915, 331895, 331925, 331935, 331945, 331955, 331965, 331977, 331987, 331998)
Safety Data Sheets (1)
Download Safety Data Sheets for QIAGEN product components.
Certificates of Analysis (1)

Publications

Multisite Evaluation of Next-Generation Methods for Small RNA Quantification.
Herbert ZT; Thimmapuram J; Xie S; Kershner JP; Kolling FW; Ringelberg CS; LeClerc A; Alekseyev YO; Fan J; Podnar JW; Stevenson HS; Sommerville G; Gupta S; Berkeley M; Koeman J; Perera A; Scott AR; Grenier JK; Malik J; Ashton JM; Pivarski KL; Wang X; Kuffel G; Mesa TE; Smith AT; Shen J; Takata Y; Volkert TL; Love JA; Zhang Y; Wang J; Xuei X; Adams M; Levine SS;
J Biomol Tech; 2020; 31 (2):47-56 2020 Jul PMID:31966025
Evaluation of methodologies for microRNA biomarker detection by next generation sequencing.
Coenen-Stass AML; Magen I; Brooks T; Ben-Dov IZ; Greensmith L; Hornstein E; Fratta P;
RNA Biol; 2018; 15 (8):1133-1145 2018 Sep 18 PMID:30223713
Validation of RNA extraction procedures focused on micro RNA expression analysis.
Remáková M; Škoda M; Faustová M; Vencovský J; Novota P;
Folia Biol (Praha); 2013; 59 (1):47-50 2013 PMID:23537528
PIWI-interacting RNAs are aberrantly expressed and may serve as novel biomarkers for diagnosis of lung adenocarcinoma.
Li J; Wang N; Zhang F; Jin S; Dong Y; Dong X; Chen Y; Kong X; Tong Y; Mi Q; Zhao Y; Zhang Y;
Thorac Cancer; 2021; 12 (18):2468-2477 2021 Aug 3 PMID:34346164
Epigenetic regulation of triple negative breast cancer (TNBC) by TGF-β signaling.
Vishnubalaji R; Alajez NM;
Sci Rep; 2021; 11 (1):15410 2021 Jul 29 PMID:34326372

FAQ

Should total RNA or small enriched RNA be used as the starting material for the QIAseq miRNA Library Kit?
Total RNA containing miRNA is the required starting material for the QIAseq miRNA Library Kit. It is not necessary to enrich for small RNA. If, however, it is desired to work with small RNA samples, small RNA represents approximately 10% of total RNA amounts. Therefore, as an example, 100 ng of total RNA translates to 10 ng small RNA; as a result, you would use the adapter and RT primer dilutions recommended for 100 ng total RNA (when working with 10 ng small RNA).

FAQ-3659
Total RNA from what sample types are compatible with the QIAseq miRNA Library Kit?
Total RNA from cells, fresh/frozen tissue, FFPE tissue, serum/plasma, bloods and other fluids are compatible with the QIAseq miRNA Library Kit.
FAQ-3660
Can miRNA sequencing libraries be prepared from total RNA isolated from heparinized plasma samples?
Heparin is a potent reverse-transcription inhibitor. After total RNA isolation from heparinized plasma samples, the heparin must be removed. One option is to treat the total RNA samples with heparinase prior to library construction with the QIAseq miRNA Library Kit. 

FAQ-3661
Are any components of the QIAseq miRNA Library Kit interchangeable with components from other QIAGEN kits?
No. The components of the QIAseq miRNA Library Kit are not interchangeable with components from any other QIAGEN kits
FAQ-3662
What are recommended stopping points during the QIAseq miRNA Library Kit procedure?
If the workflow is not expected to be completed in one day, convenient stopping points are indicated at various points in the handbook including after “cDNA cleanup” and after “library amplification cleanup”. Additionally, the libraries can be left overnight on a thermal cycler during library amplification.
FAQ-3663
What is the maximum number of available sample indexes?
With single, 6 bp indexes, the maximum number is 48. With single, 8 bp indexes, the maximum number is 96. With unique dual indexing, the maximum number is 768.
FAQ-3665
Can I still perform sequencing if my miRNA sequencing library concentrations are too low to obtain a 4 nM library?
Yes. If Library QC suggests that the library is of good quality and simply low in concentration, it can still be used for sequencing. It is possible to either sequence the library at 2nM or otherwise at the maximum amount available for that library (either individually or in multiplex with other samples). It is recommended to  keep all libraries being multiplexed at comparable concentrations


FAQ-3666
What method is used to eliminate adapter dimers from the QIAseq miRNA library?
Proprietary technology utilizing modified oligonucleotides is used to eliminate the reverse-transcription of adapter dimers.

FAQ-3667
What is the recommended read length for libraries prepared using the QIAseq miRNA Library Kit?
When using the QIAseq miRNA Library Kit in combination with QIAseq miRNA NGS 12 Index IL (cat. no. 331592), QIAseq miRNA NGS 48 Index IL (cat. no. 331595), or QIAseq miRNA NGS 96 Index IL (cat. no. 331565), the recommended protocol suggests a 75 bp single read. “FASTQ Only” should be selected, with “TruSeq Small RNA” chosen from the Sample Prep Kit dropdown menu.

When using the QIAseq miRNA Library Kit in combination with any of the QIAseq miRNA UDI kits: QIAseq miRNA 12 Index Kit IL UDI (cat. no. 331601), or QIAseq miRNA 96 Index Kit IL UDI (cat. no. 331615, 331625, 331635, 331645, 331655, 331665, 331675, 331685, 331717, 331727, or 331738), the recommended protocol suggests a 72 bp single read. “FASTQ Only” should be selected, with “TruSeq Small RNA” chosen from the Sample Prep Kit dropdown menu.

FAQ-3668
How do Unique Molecular Indexes (UMIs) improve quantification?
During the QIAseq miRNA Library Kit library construction process, each individual miRNA molecule is tagged with a UMI. Following sequencing, raw reads are mapped to individual miRNA molecules instead of just individual miRNAs. This allows for true quantification of the miRNAs by eliminating any library amplification and sequencing bias.
FAQ-3669
Does a QIAseq miRNA library include hY4 Y RNA?
No, the QIAseq miRNA Library Kit is designed to minimize the presence of hY4 Y RNA in the sequencing library

FAQ-3670
What is the sequence of the QIAseq miRNA NGS 3’ Adapter?
(5’-3’) AACTGTAGGCACCATCAAT

FAQ-3671
What is the sequence of the QIAseq miRNA NGS 5’ Adapter?
When inputting the adapter sequence for adapter trimming, the following DNA sequence should be used:

(5’–3')  GTTCAGAGTTCTACAGTCCGACGATC
FAQ-3672
What is the acceptable number of reads per sample per miRNA sequencing run?

It is recommended to allocate 5–10 million reads per sample.


FAQ-3673
Can you perform qPCR analysis of miRNAs from libraries prepared with the QIAseq miRNA Library Kit?
No, this is not advised. The miRCURY LNA products should be used for dPCR or qPCR analysis of miRNAs.
FAQ-3674
What can be used to validate results obtained with the QIAseq miRNA Library Kit?
The miRCURY LNA products should be used for dPCR or qPCR analysis of miRNAs.
FAQ-3675
What is the sequence of the UDI 5' Adapter?
(5’–3') CTACACGACGCTCTTCCGATCT

FAQ-3835
Are the QIAseq miRNA NGS 5’ Adapter and QIAseq miRNA NGS RT Initiator compatible with the QIAseq miRNA UDI kits?
No, these are not compatible. A UDI-specific 5’ adapter (UDI 5’ Adapter) and UDI-specific RT Initiator (UDI RT Initiator) are included in each QIAseq miRNA UDI kit.

FAQ-3836
What are common sized libraries observed on a TapeStation, Bioanalyzer, or similar instruments?
When using single indexes, pure miRNA libraries are approximately 180 bp, and pure dimer libraries are approximately 157 bp. If there is a peak at approximately 165–173 bp, this comprises "RNA fragments or other small RNAs that aren't miRNAs"; these are common to see in total RNA samples, being particularly strong in biofluid total RNA samples. Even if a peak is observed at 175–173 bp, there is still likely miRNAs present in the sample. Any RNA that has a 3’ OH and 5’ PO4, and is approximately 50 bp and smaller, should be robustly captured by the QIAseq miRNA Library Kit. 

When using the miRNA UDI indexes, pure miRNA libraries are approximately 200 bp, and pure dimer libraries are approximately 177 bp. If there is a peak at approximately 185–193 bp, this comprises "RNA fragments or other small RNAs that aren't miRNAs"; these are common to see in total RNA samples, being particularly strong in biofluid total RNA samples. Even if a peak is observed at 185–193 bp, there is still likely miRNAs present in the sample. Any RNA that has a 3’ OH and 5’ PO4, and is approximately 50 bp and smaller, should be robustly captured by the QIAseq miRNA Library Kit.

FAQ-3837