DNA methylation analysis based on bisulfite conversion
Exposing DNA to bisulfite rapidly leads to the deamination of unmethylated cytosines which are converted to 6-sulfonyluracil. At high pH, 6-sulfonyluracil is desulfonated to uracil, which ultimately after amplification will translate into thymidine, while methylated cytosines will not be converted. Comparing this converted DNA to the original unconverted sequence enables detailed evaluation of the location and abundance of methylated sites in CpG islands. High-resolution melting (HRM) analysis provides a rapid screening tool to accurately detect changes in CpG methylation status of bisulfite converted DNA. Detailed quantitative measures of percent methylation at individual CpG sites are obtained by Pyrosequencing. Alternative methods for broad-scale methylation analysis include methylation-specific PCR (MSP) which is highly specific and sensitive. Commercial kits are available for all forms of analysis.
Back to top
DNA methylation analysis based on restriction enzyme digest
This methodology enables the study CpG island methylation of individual genes and disease or pathway-focused gene panels without bisulfite modification. It relies on differential cleavage of target sequences by two different restriction endonucleases whose activities require either the presence or absence of methylated cytosines in their respective recognition sequences. The relative amount of DNA remaining after each enzyme digest is quantified by real-time PCR, delivering reliable calculation of the methylation status of individual genes and the methylation profile across a gene panel.
Back to top
In vivo analysis of epigenetic DNA–protein interactions
Chromatin Immunoprecipitation (ChIP) is a powerful and versatile method for analysis of chromatin DNA bound by transcription factors, co-regulators, modified histones, chromatin remodeling proteins, or other nuclear factors from live cells. It can be used for in vivo analysis of dynamic DNA–nuclear protein interactions that play a critical role in epigenetic regulation of gene expression.
Back to top
A novel epigenetic marker: 5-hydroxymethylcytosine (5 hmC)
5-methylcytosine (5-mC) is the principal epigenetic marker in mammalian genomic DNA. 5-hydroxymethylcytosine (5-hmC) is a recently discovered modification that results from the enzymatic conversion of 5-mC into 5-hmC by the TET family of oxygenases (1, 2).
There is considerable interest and speculation surrounding the role of what has been called the “sixth DNA base”, although its precise function has not yet been elucidated. Preliminary results indicate that 5-hmC may have important roles distinct from 5-mC. Evidence to-date suggests that 5-hydroxymethylcytosine may represent a new pathway to demethylate DNA involving a repair mechanism that converts hmC to C. This may have significant implications in epigenetics, accelerating epigenetic research (3).
Back to top
MSP primer design
Methylation-specific PCR (MSP) is a particularly demanding application as, in order to provide reliable results, it requires high specificity to discriminate between cytosine and thymine bases derived from methylated and unmethylated cytosines following bisulfite conversion.
Primer design for methylation-specific PCR is often difficult due to the need to cover several CpG sites per primer. This does not allow the detection of a single CpG methylation in a CpG island.
Primers should contain at least one CpG site within their sequence, and ideally be located at the far 3'-end of their sequence in order to discriminate maximally methylated DNA against unmethylated DNA.
Primers should have an adequate number of non-CpG Cs in their sequence to amplify only the bisulfite-modified DNA. Primers with more non-CpG Cs are preferred.
Primers for methylated DNA (M pair) and for unmethylated DNA (U pair) should contain the same CpG sites within their sequence. For example, if a forward primer in the M pair has this sequence: ATTAGTTTCGTTTAAGGTTCGA, the forward primer in the U pair must also contain the two CpG sites, e.g., ATTAGTTTTGTTTAAGGTTTGA; although they may differ in length and start position. The M pair and U pair should also ideally have a similar annealing temperature.
Back to top
Control DNA
Control reactions should be performed when undertaking methylation analysis, for example, when performing methylation-specific PCR (MSP), to ensure that the PCR primers are specific for the detection of methylated or unmethylated bisulfite converted DNA.
To perform control reactions, methylated bisulfite converted DNA, unmethylated bisulfite converted DNA, and genomic DNA are required. Each type of DNA should be used to show the specificity of the PCR. For example, the primer specific for methylated DNA will only show a signal for the methylated control DNA (see table Expected PCR results with controls).
In addition, genomic DNA can be used to determine the bisulfite conversion efficiency of bisulfite reactions.
| Unmethylated control DNA |
PCR product |
No PCR product |
No PCR product |
| Unmethylated control DNA (bisulfite converted) |
No PCR product |
PCR product |
No PCR product |
| Methylated control DNA (bisulfite converted) |
No PCR product |
No PCR product |
PCR product |
| No-template control |
No PCR product |
No PCR product |
No PCR product |
Back to top
References
- Kriaucionis, S., and Heintz, N. (2009) The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science 324, 929.
- Tahiliani, M., et al. (2009) Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 324, 930.
- Ito, S., et al. (2010) Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification., Nature 26, 1129.
- Jin, S.G., Kadam, S., and Pfeifer, G.P. (2010) Examination of the specificity of DNA methylation profiling techniques towards 5-methylcytosine and 5-hydroxymethylcytosine. Nucleic Acids Res. 38, e125.
- Huang, Y., et al. (2010) The behaviour of 5-hydroxymethylcytosine in bisulfite sequencing. PLoS One 26, e8888.
- Nestor, C., et al. (2010) Enzymatic approaches and bisulfite sequencing cannot distinguish between 5-methylcytosine and 5-hydroxymethylcytosine in DNA. Biotechniques 48, 317.
Back to top