What is the sequence of the QIAseq miRNA NGS 5’ Adapter?
FAQ ID - 3672

(5’-3’) GUUCAGAGUUCUACAGUCCGACGAUC