Mm/Hs_MAPK1 Control siRNA
For a positive control knockdown in siRNA experiments
siRNA control for human or mouse mitogen-activated protein kinase-1.
The Mm/Hs_MAPK1 Control siRNA is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.
Principle
fragment fix placeholder
Recommended for you
Sample to Insight
Location:
United Kingdom
Language:
English
© QIAGEN 2013–2017. All rights reserved.
|
Mm/Hs_MAPK1 Control siRNA
For a positive control knockdown in siRNA experiments
siRNA control for human or mouse mitogen-activated protein kinase-1.
|
Cat No./ID: 1022564
Mm/Hs_MAPK1 control siRNA (5 nmol)
£118.00
Order Product
Mm/Hs_MAPK1 control siRNA (5 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
|
|
Cat No./ID: 1027321
Mm/Hs_MAPK1 control siRNA (20 nmol)
£188.00
Order Product
Mm/Hs_MAPK1 control siRNA (20 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
|
The Mm/Hs_MAPK1 Control siRNA is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.
Principle
| siRNA type | Control |
| Sense sequence | UGCUGACUCCAAAGCUCUGdTdT |
| Antisense sequence | CAGAGCUUUGGAGUCAGCAdTdT |
| Target DNA sequence | AATGCTGACTCCAAAGCTCTG |
| Dye label/detection | – |
Recommended for you
-
Cat No./ID: 1027416
FlexiTube GeneSolution
siRNA GeneSolution details -
Cat No./ID: 1027281
AllStars Neg. Control siRNA (20 nmol)
Thoroughly tested and validated nonsilencing siRNA£188.00 -
Cat No./ID: 1027280
AllStars Negative Control siRNA (5 nmol)
Thoroughly tested and validated nonsilencing siRNA£118.00
