Resources

Epigenetics Protocols & Applications

Epigenetics
The study of epigenetic mechanisms and DNA methylation are discussed in this section, together with their applications
  • Main Image Navi

The study of epigenetic mechanisms and DNA methylation has become increasingly important in many areas of research, including DNA repair, cell cycle control, developmental biology, cancer research, identification of biomarkers, predisposition factors, and potential drug targets.

DNA methylation analysis based on bisulfite conversion
DNA methylation analysis based on restriction enzyme digest
In vivo analysis of epigenetic DNA–protein interactions
A novel epigenetic marker: 5-hydroxymethylcytosine (5 hmC)
MSP primer design
Control DNA
References

DNA methylation analysis based on bisulfite conversion

Exposing DNA to bisulfite rapidly leads to the deamination of unmethylated cytosines which are converted to 6-sulfonyluracil. At high pH, 6-sulfonyluracil is desulfonated to uracil, which ultimately after amplification will translate into thymidine, while methylated cytosines will not be converted. Comparing this converted DNA to the original unconverted sequence enables detailed evaluation of the location and abundance of methylated sites in CpG islands. High-resolution melting (HRM) analysis provides a rapid screening tool to accurately detect changes in CpG methylation status of bisulfite converted DNA. Detailed quantitative measures of percent methylation at individual CpG sites are obtained by Pyrosequencing. Alternative methods for broad-scale methylation analysis include methylation-specific PCR (MSP) which is highly specific and sensitive. Commercial kits are available for all forms of analysis.

Back to top

 DNA methylation analysis based on restriction enzyme digest

This methodology enables the study CpG island methylation of individual genes and disease or pathway-focused gene panels without bisulfite modification. It relies on differential cleavage of target sequences by two different restriction endonucleases whose activities require either the presence or absence of methylated cytosines in their respective recognition sequences. The relative amount of DNA remaining after each enzyme digest is quantified by real-time PCR, delivering reliable calculation of the methylation status of individual genes and the methylation profile across a gene panel.

Back to top

In vivo analysis of epigenetic DNA–protein interactions

Chromatin Immunoprecipitation (ChIP) is a powerful and versatile method for analysis of chromatin DNA bound by transcription factors, co-regulators, modified histones, chromatin remodeling proteins, or other nuclear factors from live cells. It can be used for in vivo analysis of dynamic DNA–nuclear protein interactions that play a critical role in epigenetic regulation of gene expression.

Back to top

A novel epigenetic marker: 5-hydroxymethylcytosine (5 hmC)

5-methylcytosine (5-mC) is the principal epigenetic marker in mammalian genomic DNA. 5-hydroxymethylcytosine (5-hmC) is a recently discovered modification that results from the enzymatic conversion of 5-mC into 5-hmC by the TET family of oxygenases (1, 2).

There is considerable interest and speculation surrounding the role of what has been called the “sixth DNA base”, although its precise function has not yet been elucidated. Preliminary results indicate that 5-hmC may have important roles distinct from 5-mC. Evidence to-date suggests that 5-hydroxymethylcytosine may represent a new pathway to demethylate DNA involving a repair mechanism that converts hmC to C. This may have significant implications in epigenetics, accelerating epigenetic research (3).

Back to top

MSP primer design

Methylation-specific PCR (MSP) is a particularly demanding application as, in order to provide reliable results, it requires high specificity to discriminate between cytosine and thymine bases derived from methylated and unmethylated cytosines following bisulfite conversion.

Primer design for methylation-specific PCR is often difficult due to the need to cover several CpG sites per primer. This does not allow the detection of a single CpG methylation in a CpG island.

Primers should contain at least one CpG site within their sequence, and ideally be located at the far 3'-end of their sequence in order to discriminate maximally methylated DNA against unmethylated DNA.

Primers should have an adequate number of non-CpG Cs in their sequence to amplify only the bisulfite-modified DNA. Primers with more non-CpG Cs are preferred.

Primers for methylated DNA (M pair) and for unmethylated DNA (U pair) should contain the same CpG sites within their sequence. For example, if a forward primer in the M pair has this sequence: ATTAGTTTCGTTTAAGGTTCGA, the forward primer in the U pair must also contain the two CpG sites, e.g., ATTAGTTTTGTTTAAGGTTTGA; although they may differ in length and start position. The M pair and U pair should also ideally have a similar annealing temperature.

Back to top

Control DNA

Control reactions should be performed when undertaking methylation analysis, for example, when performing methylation-specific PCR (MSP), to ensure that the PCR primers are specific for the detection of methylated or unmethylated bisulfite converted DNA.

To perform control reactions, methylated bisulfite converted DNA, unmethylated bisulfite converted DNA, and genomic DNA are required. Each type of DNA should be used to show the specificity of the PCR. For example, the primer specific for methylated DNA will only show a signal for the methylated control DNA (see table Expected PCR results with controls).

In addition, genomic DNA can be used to determine the bisulfite conversion efficiency of bisulfite reactions.

Expected PCR results with controls
Type of DNA  Primer for unmethylated target gene (PCR 1)  Primer for unmethylated target gene (bisulfite converted) (PCR 2) Primer for methylated target gene (bisulfite converted) (PCR 3)
Unmethylated control DNA  PCR product  No PCR product  No PCR product
Unmethylated control DNA (bisulfite converted)  No PCR product  PCR product  No PCR product
Methylated control DNA (bisulfite converted)  No PCR product  No PCR product  PCR product
No-template control  No PCR product  No PCR product  No PCR product

Back to top

References

  1. Kriaucionis, S., and Heintz, N. (2009) The nuclear DNA base 5-hydroxymethylcytosine is present in Purkinje neurons and the brain. Science 324, 929.
  2. Tahiliani, M., et al. (2009) Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1. Science 324, 930. 
  3. Ito, S., et al. (2010) Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification., Nature 26, 1129.
  4. Jin, S.G., Kadam, S., and Pfeifer, G.P. (2010) Examination of the specificity of DNA methylation profiling techniques towards 5-methylcytosine and 5-hydroxymethylcytosine. Nucleic Acids Res. 38, e125. 
  5. Huang, Y., et al. (2010) The behaviour of 5-hydroxymethylcytosine in bisulfite sequencing. PLoS One 26, e8888. 
  6. Nestor, C., et al. (2010) Enzymatic approaches and bisulfite sequencing cannot distinguish between 5-methylcytosine and 5-hydroxymethylcytosine in DNA. Biotechniques 48, 317.

Back to top


Resources

You are not authorized to download the resource

DNA
1
Isolation and quantification of genomic DNA from different sample sources and plasmid DNA. How to make and transform competent cells, how to culture and handle plasmid-containing cells, and commonly used techniques for analysis of genomic DNA.
View
RNA
1
This section describes considerations for isolation and quantification of RNA from different sample sources and RNA storage. It also deals with RNAi and the use of siRNA, together with miRNA, mimics, and inhibitors.
View
PCR
1
This section provides a comprehensive guide to PCR. It also includes guidelines and suggestions for maximizing results from your PCR.
View
Whole Genome Amplification
1
Whole genome amplification was developed as a way of increasing the amount of limited DNA samples. This is particularly useful for forensics and genetic disease research, where DNA quantities are limited, but many analyses are required. Various WGA techniques have been developed that differ both in their protocols, amplification accuracy, and ease-of-use.
View
Next Generation Sequencing
1
Following the completion of the human genome project, the high demand for low-cost sequencing has given rise to a number of high-throughput, next-generation sequencing (NGS) technologies. These new sequencing platforms allow high-throughput sequencing for a wide range of applications.
View
Transfection
1
Transfection — the delivery of DNA or RNA into eukaryotic cells — is a powerful tool used to study and control gene expression.
View
Protein
1
As well as providing some general background into proteins and their biology, this guide covers commonly used protocols for expression, purification, analysis, detection and assays.
View
Animal Cell Culture
1
Useful hints for culturing animal cells (i.e., cells derived from higher eukaryotes such as mammals, birds, and insects). The guide covers different types of animal cell cultures, considerations for cell culture, and cell culture protocols.
View