text.skipToContent text.skipToNavigation

miScript II RT Kit

For reverse transcription of total RNA containing miRNA using the miScript PCR System

  • cDNA for sensitive and specific miRNA detection
  • A single cDNA enables quantification of multiple miRNAs
  • Quantification of miRNA and mRNA from the same cDNA
  • Quantification of mature and precursor miRNA from the same cDNA
  • Proprietary synthetic RNA to assess reverse transcription efficiency
The miScript II RT Kit is an integral component of the miScript PCR System for miRNA detection and quantification. cDNA generated with the miScript II RT Kit is used as a template for real-time PCR with the miScript SYBR Green PCR Kit and either PCR arrays (miRNome or Pathway-Focused miScript miRNA PCR Arrays) or appropriate assays (miScript Primer Assays for miRNA or other noncoding RNA, miScript Precursor Assays for precursor miRNA, or QuantiTect Primer Assays for mRNA).

Buy Products

Cat No./ID: 218160
miScript II RT Kit (12)
HK$1,470.00
Order Product
For 12 cDNA synthesis reactions: miScript Reverse Transcriptase Mix, 10x miScript Nucleics Mix, 5x miScript HiSpec Buffer, 5x miScript HiFlex Buffer, RNase-Free Water
Cat No./ID: 218161
miScript II RT Kit (50)
HK$5,370.00
Order Product
For 50 cDNA synthesis reactions: miScript Reverse Transcriptase Mix, 10x miScript Nucleics Mix, 5x miScript HiSpec Buffer, 5x miScript HiFlex Buffer, RNase-Free Water
The miScript II RT Kit is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.

Product Details

9
Reproducible results in technical and biological replicates.
Total RNA was purified using the miRNeasy Mini Kit from [A] 2 identical HeLa S3 cell pellets with identical passage numbers and [B] 2 HeLa S3 cell pellets collected from different parental stocks at different times. Using the miScript PCR System, cDNA was prepared and used as a template in real-time PCR with the miFinder miScript miRNA PCR Array. Plotting CT values of the replicates against each other demonstrated the high technical and biological reproducibility of the results. These experiments were performed by a first-time user of the miScript PCR System.
9
Selective conversion of mature miRNAs into cDNA in miScript HiSpec Buffer.

In a reverse transcription reaction with miScript HiSpec Buffer, mature miRNAs are polyadenylated by poly(A) polymerase and converted into cDNA by reverse transcriptase with oligo-dT priming. The cDNA is then used for real-time PCR quantification of mature miRNA expression.

9
Simultaneous conversion of all RNA species into cDNA in miScript HiFlex Buffer.

In a reverse transcription reaction with miScript HiFlex Buffer, miRNAs and other noncoding RNAs (ncRNAs) are polyadenylated by poly(A) polymerase and converted into cDNA by reverse transcriptase with oligo-dT priming. mRNAs are converted into cDNA by reverse transcriptase using both oligo-dT and random priming. Detection of mature miRNA, precursor miRNA, other ncRNA, and mRNA can be performed using the appropriate assays.

9
miScript II RT Kit buffers.

Two buffers are supplied with the miScript II RT Kit. Use miScript HiSpec Buffer for cDNA synthesis to enable either mature miRNA profiling (using miScript miRNA PCR Arrays) or mature miRNA quantification using individual miScript Primer Assays. Use miScript HiFlex Buffer for cDNA synthesis to enable quantification of mature miRNA, precursor miRNA, noncoding RNA (ncRNA), and/or mRNA from the same cDNA. cDNA prepared using either miScript HiSpec Buffer or miScript HiFlex Buffer can be used with miScript PCR Controls.

Performance

The miScript II RT Kit, together with the components of the miScript PCR System, ensures sensitive, specific miRNA detection and quantification. As many miRNAs are expressed at low levels, sensitivity is critical to ensure reliable data. The miScript PCR System provides exceptional sensitivity, a broad dynamic range, and consistently high amplification efficiencies. The high performance of the miScript PCR System ensures highly reproducible results between technical and biological replicates at the first attempt (see figure Reproducible results in technical and biological replicates).

High specificity

Many miRNA isoforms families exist in which miRNAs differ by only a single base. This presents a significant challenge in miRNA quantification. The miScript PCR System can efficiently discriminate between closely related miRNA isoforms, even when they differ by only a single base (see tables).

Specificity of the miScript PCR System
  miRNA sequence
Let-7b UGAGGUAGUAGGUUGUGUGGUU
Let-7c UGAGGUAGUAGGUUGUAUGGUU
miR-98 UGAGGUAGUAAGUUGUAUUGUU
Let-7d AGAGGUAGUAGGUUGCAUAGUU
Let-7e UGAGGUAGGAGGUUGUAUAGUU
Let-7a UGAGGUAGUAGGUUGUAUAGUU
Let-7f UGAGGUAGUAGAUUGUAUAGUU
Let-7g UGAGGUAGUAGUUUGUACAGUU
Let-7i UGAGGUAGUAGUUUGUGCUGUU

 

cDNA used in PCR Let-7b Let-7c miR-98 Let-7d Let-7e Let-7a Let-7f Let-7g Let-7i
Let-7b 100.00 1.78 0.00 0.00 0.00 0.01 0.00 0.00 0.01
Let-7c 0.54 100.00 0.00 0.00 1.01 0.12 0.00 0.00 0.00
miR-98 0.00 0.21 100.00 0.06 0.01 0.05 0.00 0.01 0.13
Let-7d 0.05 0.02 0.00 100.00 0.00 0.38 0.00 0.00 0.01
Let-7e 0.05 0.01 0.00 0.02 100.00 0.23 0.00 0.00 0.01
Let-7a 0.07 0.64 0.00 0.54 3.86 100.00 0.06 0.04 0.02
Let-7f 0.55 0.12 0.01 0.11 0.03 1.05 100.00 0.14 0.13
Let-7g 0.58 0.17 0.01 0.08 0.00 0.04 0.01 100.00 0.17
Let-7i 0.13 0.02 0.01 0.02 0.00 0.01 0.00 0.10 100.00
The RNA sequences of the Let-7 isoforms are shown. Base changes are bold and underlined. Synthetic miRNAs of each Let-7 isoform (Let-7a-Let-7i, miR-98) were used in cDNA synthesis reactions performed with the miScript II RT Kit using miScript HiFlex Buffer. The same experiment performed using miScript HiSpec Buffer gave similar results (data not shown). An aliquot of each cDNA was used as template in real-time PCR reactions with a miScript Primer Assay for each isoform and the miScript SYBR® Green PCR Kit. The % relative detection was calculated using the differences between the CT values achieved from the mismatching miScript Primer Assays and those from the perfectly matching miScript Primer Assays (% relative detection = 2-ΔCT x 100). This data demonstrates the ability of the miScript PCR System to efficiently discriminate between closely related isoform family members.
Principle

The miScript PCR System enables sensitive, specific miRNA quantification and profiling using SYBR Green-based real-time PCR. The miScript PCR System covers all the steps involved in conversion of RNA to cDNA and subsequent real-time PCR detection of miRNAs.

The miScript PCR System comprises:

miScript II RT Kit — this kit enables simple, single-step cDNA synthesis. A single cDNA synthesis reaction can be used for detection of hundreds of miRNAs. The dual buffer system meets the distinctive needs of miRNA quantification using real-time PCR.
miScript PreAMP PCR Kit and Primer Mixes — the kit and primer mixes enable unbiased preamplification of limited miRNA amounts, allowing subsequent miRNA profiling.  
miScript SYBR Green PCR Kit — this kit includes QuantiTect SYBR Green PCR Master Mix and the miScript Universal Primer, a reverse primer that allows detection of miRNAs in combination with a miScript Primer Assay or miScript miRNA PCR Array.
miScript Primer Assay or miScript Precursor Assay — miScript Primer Assays are miRNA-specific forward primers designed to detect mature miRNAs. miScript Precursor Assays consist of forward and reverse primers targeting precursor miRNA stem-loop sequences. Assays are designed using the most up-to-date sequence information from miRBase.
miScript miRNA PCR Array — miRNome or Pathway-Focused miScript miRNA PCR Arrays are preformatted, single-use PCR arrays for rapid profiling of mature miRNAs.
miScript miRNA PCR Array data analysis tool — this complimentary, Web-based tool simplifies the ΔΔCT method of relative quantification for miScript miRNA PCR Arrays.
miScript II RT Kit dual buffer system

The miScript II RT Kit includes miScript Reverse Transcriptase Mix, 10x miScript Nucleics Mix, 5x miScript HiSpec Buffer, and 5x miScript HiFlex Buffer. miScript Reverse Transcriptase Mix is an optimized blend of poly(A) polymerase and reverse transcriptase. miScript Nucleics Mix contains dNTPs, rATP, oligo-dT primers, and an internal synthetic RNA control (miRNA reverse transcription control [miRTC]) that is used to assess reverse transcription performance during profiling experiments with miScript miRNA PCR Arrays (for more information, see the miScript miRNA PCR Array Handbook).

Two buffers, miScript HiSpec Buffer and miScript HiFlex Buffer, are provided in the miScript II RT Kit to meet the distinctive needs of miRNA quantification studies using real-time PCR (see figure miScript II RT Kit buffers). miScript HiSpec Buffer is specifically formulated to provide optimal results in mature miRNA profiling and quantification experiments using miScript miRNA PCR Arrays and miScript Primer Assays. miScript HiFlex Buffer is highly suited to low-throughput miRNA quantification experiments, in addition to experiments where different RNA species, such as miRNA, mRNA, and precursor miRNA, are quantified from the same sample.

Reverse transcription in miScript HiSpec Buffer

Reverse transcription reactions performed using miScript HiSpec Buffer ensure the selective conversion of mature miRNAs and the targets of miScript PCR Controls into cDNA. Mature miRNAs are polyadenylated by poly(A) polymerase and reverse transcribed into cDNA using oligo-dT primers (see figure Selective conversion of mature miRNAs into cDNA in miScript HiSpec Buffer). Polyadenylation and reverse transcription are performed in parallel in the same tube. The oligo-dT primers have a 3' degenerate anchor and a universal tag sequence on the 5' end, allowing amplification of mature miRNA in the real-time PCR step. miScript Primer Assays, used in combination with the miScript SYBR Green PCR Kit, enable sensitive, specific quantification of mature miRNA by real-time PCR. The combination of polyadenylation and the universal tag addition ensures that miScript Primer Assays do not detect genomic DNA.

Reverse transcription in miScript HiFlex Buffer

Reverse transcription reactions performed using miScript HiFlex Buffer allow the conversion of all RNA species into cDNA (see figure Simultaneous conversion of all RNA species into cDNA in miScript HiFlex Buffer). Mature miRNAs are polyadenylated by poly(A) polymerase and reverse transcribed into cDNA using oligo-dT primers. Polyadenylation and reverse transcription are performed in parallel in the same tube. The oligo-dT primers have a 3' degenerate anchor and a universal tag sequence on the 5' end allowing amplification of mature miRNA in the real-time PCR step. miScript Primer Assays, used in combination with the miScript SYBR Green PCR Kit, enable quantification of mature miRNA by real-time PCR. The combination of polyadenylation and the universal tag addition ensures that miScript Primer Assays do not detect genomic DNA. All other RNA species (including precursor miRNA, other noncoding RNA, and mRNA) are also converted into cDNA using oligo-dT and random primers. Real-time PCR detection of these RNAs can then be performed using the appropriate assays (e.g., miScript Primer Assays for noncoding RNA detection, miScript Precursor Assays for precursor miRNA detection, and QuantiTect Primer Assays for mRNA detection) in combination with the miScript SYBR Green PCR Kit (see figure Simultaneous conversion of all RNA species into cDNA in miScript HiFlex Buffer).

Procedure
Reverse transcription reactions are easy to perform. Total RNA containing miRNA is used as starting material for reverse transcription reactions. Reverse transcription is a straightforward procedure which includes incubation of the reaction at 37oC for 1 hour, followed by inactivation of the reaction by briefly incubating at 95oC.
Applications

The miScript II RT Kit is used as part of the miScript PCR System for:

Mature miRNA quantification and profiling
miRNA and mRNA detection in parallel
Mature miRNA and precursor miRNA detection in parallel
snoRNA and other noncoding RNA detection

Product Resources

You are not authorized to download the resource

Kit Handbooks (4)

Show details
For real-time PCR analysis of microRNA using SYBR Green detection
Show details
For real-time profiling of miRNAs using the Fluidigm BioMark System
Show details

miScript II RT Kit

miScript SYBR Green PCR Kit

miScript miRNA PCR Arrays

miScript miRNA QC PCR Array

For SYBR Green-based, real-time PCR profiling of microRNAs using pathway-focused arrays, HC arrays, and miRNome arrays


Show details
fragment fix placeholder

Product citations in scientific articles

See more details on Bioz

Customers who bought these products also bought

Please be advised that your location has been changed to Brazil.
If you wish to change your location back to Luxembourg please use the Location Selector at the base of this page.