text.skipToContent text.skipToNavigation

Mm/Hs_MAPK1 Control siRNA

For a positive control knockdown in siRNA experiments
siRNA control for human or mouse mitogen-activated protein kinase-1.
Cat No./ID: 1022564
Mm/Hs_MAPK1 control siRNA (5 nmol)
Mm/Hs_MAPK1 control siRNA (5 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
Cat No./ID: 1027321
Mm/Hs_MAPK1 control siRNA (20 nmol)
Mm/Hs_MAPK1 control siRNA (20 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
Principle
Mm/Hs_MAPK1 control siRNA product details
siRNA type Control
Sense sequence UGCUGACUCCAAAGCUCUGdTdT
Antisense sequence CAGAGCUUUGGAGUCAGCAdTdT
Target DNA sequence AATGCTGACTCCAAAGCTCTG
Dye label/detection                     –

Server Error
    Server currently not available


    An internal server error has occurred.
    We apologize for any inconvenience the error might have on your browsing experience on our web site.



    Use the links below to find the information you need.