For a positive control knockdown in siRNA experiments
siRNA control for human or mouse mitogen-activated protein kinase-1.
Product Product no. Cat. no. List price:
 
 
show details
    varies
Can't order online?
To place an order via phone, email or for requesting a quote, please provide the product’s name, number and catalog number.
Product Cat. no. List price:
Mm/Hs_MAPK1 control siRNA (5 nmol)
Mm/Hs_MAPK1 control siRNA (5 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
1022564
158,00 €
Mm/Hs_MAPK1 control siRNA (20 nmol)
Mm/Hs_MAPK1 control siRNA (20 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
1027321
251,00 €
The Mm/Hs_MAPK1 Control siRNA is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.
  • Main Image Navi
Principle
Mm/Hs_MAPK1 control siRNA product details
siRNA type Control
Sense sequence UGCUGACUCCAAAGCUCUGdTdT
Antisense sequence CAGAGCUUUGGAGUCAGCAdTdT
Target DNA sequence AATGCTGACTCCAAAGCTCTG
Dye label/detection                     –

You are not authorized to download the resource