Development of a 10-plex Microsatellite Marker System for Successful Dog Typing

Overcome the challenges of multiplex microsatellite PCR
  • Main Image Navi
Microsatellite analysis is a challenging technique that requires amplification of several products in parallel in a single reaction tube. High-resolution analysis on a capillary sequencing system has been applied in many areas of DNA testing, such as marker-assisted breeding, species identification, and population genetics.

There are 2 major challenges associated with performing multiplex microsatellite PCR:
  • Choosing primer sets that are suitable for unambiguous typing of individuals
  • Laborious, time-consuming optimization procedures

Here we describe a novel method of dog typing using a 10-plex marker system. QIAGEN chose 10 primer pairs from a list of published canine markers (1). Using the Type-it Microsatellite PCR Kit, 10-plex microsatellite PCR analysis was performed, without optimization of reaction conditions, and this enabled successful typing of 3 different dogs.
Identification of suitable primers for 10-plex microsatellite PCR analysis
Fast and easy microsatellite analysis without optimization
Identification of suitable primers for 10-plex microsatellite PCR analysis 
QIAGEN initially selected 20 primer pairs from the published list of canine primers, based on the expected size of the PCR products. Primer pairs were selected so that each pair would produce a PCR product of unique size, so that the different PCR products, detected by the same fluorophore, did not overlap. These 20 primer pairs were tested individually. If a primer pair enabled unambiguous separation of alleles on the sequencing instrument, it was selected. The chosen primer pairs, 10 primer pairs in total (see “Primers used for 10plex microsatellite analysis of canine DNA”), were then used in 10plex amplification reactions, under standard conditions, using the Type-it Microsatellite PCR Kit in combination with the ABI 3700 capillary sequencer. Optimization of PCR conditions was not required. PCR analysis was performed using 2 dye channels, FAM and NED, where 6 microsatellites were identified in the FAM channel and 4 microsatellites were identified in the NED channel. This approach enabled successful typing of 3 different breeds of dog (See figure Successful dog typing without the need for optimization).
Primers used for 10plex microsatellite analysis of canine DNA
Dye channel Marker Actual fragment size (bp) Detected fragment size (bp) Repeat Sequence
 FAM C08.410 10,18,20 112  109–117 di F:GAGGAAAACCAAGTGATTTTGG
C01.2468, 18, 20  124  123–128 di F:GACTTCATTCATCCATTCATGA
CXX.672 7,10,18,20  156  150–156 di F:AGGTCAGGGACAATATACCGT
C01.42410, 18, 20  188  176–193 di F:AGCTTAGCTTACTGCCCTGG
FH2060 9,20  223  217–229 tetra F:GTTTTGAGGAAGCCTTGCTG
C26.73320  257  256–264 di F:CCCTCTACTTATGTCTCGGCC
 NED CXX.279 8,18,20  124–126  113–129 di F:TGCTCAATGAAATAAGCCAGG
CXX873 18,21,22  140–144  136–144 di F:CTGGCAGATTACAGGTAGC
FH2516 19  188  182-188  tetra F:AATGGATGGAACTTAGGGCA
FH20169, 20  285-309  281-318  tetra F:CATTTTTAAGGATGGAGACAGC

Fast and easy microsatellite analysis without optimization 
Multiplexed microsatellite analysis is a highly demanding technique used for STR and VNTR analysis, and can be used to amplify and detect even a single copy of a nucleic acid sequence. Traditionally, multiplex STR analysis has required extensive optimization of annealing conditions, and enzyme and buffer concentrations, for maximum amplification efficiency of each marker marker and to obtain fluorescent signals that can be reliably detected on the capillary-based sequencing instrument.

Compared to singleplex STR systems using 2 primers, an additional challenge of multiplexed STR analysis is the varying hybridization kinetics of different primer pairs. Differences in hybridization efficiency of primers may result in poor yield of some of the PCR products. This often results in missing peaks.

QIAGEN has overcome the problem with the specially adapted Type-it Microsatellite PCR Buffer (supplied with the Type-it Microsatellite PCR Kit; see figure Unique Type-it Microsatellite PCR Buffer). This buffer contains a unique synthetic additive, Factor MP, which further promotes stable and efficient annealing of all the different primers to the nucleic acid template in a multiplex reaction. The increased hybridization efficiency and primer stability provide excellent and comparable product yields for all targets. Preoptimized concentrations of HotStarTaq Plus DNA Polymerase ensure high specificity and sensitivity, even in a multiplex reaction. Nonspecific annealing is minimized, which leads to maximal yields of specific PCR products. In addition, optimized protocols are provided for successful analysis on a high-resolution sequencing instrument at first attempt.


The 10 chosen canine primer pairs, in combination with the Type-it Microsatellite PCR Kit enabled fast and easy typing of 3 different dogs, without the need for optimization. This demonstrates that new multiplex STR assays can be easily established based on published primers sequences. Even primers that have been described for singleplex PCR can be combined in multiplex assays, enabling successful typing. The unique features of the Type-it Microsatellite PCR Kit make it highly suitable for all potential microsatellite, minisatellite, or STR applications, without tedious and time-consuming optimization.

Richmann, M. et al. (2001) Characterization of a minimal screening set of 172 microsatellite markers for genome-wide screens of the canine genome. J. Biochem. Biophys. Methods 47 137.

For up-to-date licensing information and product-specific disclaimers, see the respective QIAGEN kit handbook or user manual. QIAGEN kit handbooks and user manuals are available at or can be requested from QIAGEN Technical Services or your local distributor.

Top products
For fast and reliable multiplex PCR analysis of microsatellite loci
Show details
See products

You are not authorized to download the resource