text.skipToContent text.skipToNavigation

Mm/Hs_MAPK1 Control siRNA

For a positive control knockdown in siRNA experiments
siRNA control for human or mouse mitogen-activated protein kinase-1.
Cat No./ID: 1022564
Mm/Hs_MAPK1 control siRNA (5 nmol)
€159.00
Add To Cart
Mm/Hs_MAPK1 control siRNA (5 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
Cat No./ID: 1027321
Mm/Hs_MAPK1 control siRNA (20 nmol)
€250.00
Add To Cart
Mm/Hs_MAPK1 control siRNA (20 nmol) (NM_001038663, NM_002745, NM_011949, NM_138957)
The Mm/Hs_MAPK1 Control siRNA is intended for molecular biology applications. This product is not intended for the diagnosis, prevention, or treatment of a disease.
Principle
Mm/Hs_MAPK1 control siRNA product details
siRNA type Control
Sense sequence UGCUGACUCCAAAGCUCUGdTdT
Antisense sequence CAGAGCUUUGGAGUCAGCAdTdT
Target DNA sequence AATGCTGACTCCAAAGCTCTG
Dye label/detection                     –

fragment fix placeholder

Customers who bought these products also bought