For quantification of mature miRNA using the miScript PCR System

  • Sensitive and specific detection and quantification of miRNA
  • Custom assay design for mature miRNAs not listed in miRBase
  • Convenient ordering via GeneGlobe
miScript Primer Assays are miRNA-specific primers available for all human, mouse, rat, and dog miRNAs listed in the current version of miRBase. miScript Primer Assays are part of the miScript PCR System for miRNA detection and quantification. cDNA is prepared using the miScript II RT Kit with miScript HiSpec Buffer (for mature miRNA detection only) or miScript HiFlex Buffer (for parallel quantification of all RNA species using appropriate assays). Either cDNA is used as a template in real-time PCR with a miScript Primer Assay and the miScript SYBR Green PCR Kit.
Quantity Product Cat. no. Price
 
 
show details
  varies Add to wishlist
Available Controls
Configure
Quantity Product Cat. no. Price
 
 
show details
  varies Add to wishlist

Can’t order online or need plate formats? Order Forms and Plate Orders

miScript Primer Assays are intended for molecular biology applications. These products are not intended for the diagnosis, prevention, or treatment of a disease.


  • Main Image Navi
Accurate detection of as low as 10 miRNA copies.|Broad dynamic range and high amplification efficiencies.|
Synthetic miR-21 was used to generate cDNA using the miScript II RT Kit with [A] miScript HiSpec Buffer or [B] miScript HiFlex Buffer (both provided in the kit). A range of amounts from 10 copies to 106 copies of this cDNA was used in real-time PCR using the miScript PCR System. Real-time PCR was performed on the Rotor-Gene Q cycler. The resultant CT values decreased linearly with increasing miRNA copy number, indicating sensitive detection from a wide range of template amounts.|Total RNA was purified from HeLa S3 cells using the miRNeasy Mini Kit. cDNA was prepared from a range of RNA amounts from 10 pg to 2 µg using the miScript II RT Kit with [A] miScript HiSpec Buffer or [B] miScript HiFlex Buffer (both provided in the kit). Each cDNA was used as a template in real-time PCR reactions using a miScript Primer Assays for miR-16, miR-20a, or miR-21. Linear standard curves demonstrated the broad dynamic detection range and high amplification efficiency of the miScript PCR System.|
Performance
Reproducible, reliable results are ensured using the miScript Primer Assays with the miScript PCR System for mature miRNA detection. As many miRNAs are expressed at low levels, sensitivity is critical to ensure reliable data. The miScript PCR System provides exceptional sensitivity, detecting as low as 10 miRNA copies (see figure Accurate detection of as low as 10 miRNA copies). Accurate, reproducible miRNA data is provided from as little as 10 pg total RNA (see figure Broad dynamic range and high amplification efficiencies). Amplification efficiencies are consistently high, enabling accurate expression analysis of multiple miRNAs using the ∆∆CT method.
Principle

The miScript PCR System enables sensitive, specific miRNA quantification and profiling using SYBR® Green-based real-time PCR. The miScript PCR System covers all the steps involved in conversion of RNA to cDNA and subsequent real-time PCR detection of miRNAs.

For mature miRNA detection and quantification using the miScript PCR System, the following components are used:

miScript II RT Kit — this kit enables simple, single-step cDNA synthesis. A single cDNA synthesis reaction can be used for detection of hundreds of miRNAs. The dual buffer system meets the distinctive needs of miRNA quantification using real-time PCR.
miScript PreAMP PCR Kit and Primer Mixes — the kit and primer mixes enable unbiased preamplification of limited miRNA amounts, allowing subsequent miRNA profiling.
miScript SYBR® Green PCR Kit — this kit includes QuantiTect SYBR® Green PCR Master Mix and the miScript Universal Primer, a reverse primer that allows detection of miRNAs in combination with a miScript Primer Assay or miScript miRNA PCR Array.

miScript Primer Assay — miScript Primer Assays are miRNA-specific forward primers designed to detect mature miRNAs using the most up-to-date information from miRBase.

Procedure

For detection of mature miRNA, cDNA prepared in a reverse transcription reaction using miScript HiSpec Buffer or miScript HiFlex Buffer from the miScript II RT Kit serves as the template for real-time PCR. Real-time PCR is performed using an miRNA-specific miScript Primer Assay (forward primer) and the miScript SYBR Green PCR Kit, which contains the miScript Universal Primer (reverse primer) and QuantiTect SYBR Green PCR Master Mix.

For detection of other noncoding RNA, cDNA prepared in a reverse transcription reaction using miScript HiFlex Buffer from the miScript II RT Kit serves as the template for real-time PCR. Real-time PCR is performed using a miScript Primer Assay (forward primer) and the miScript SYBR Green PCR Kit, which contains the miScript Universal Primer (reverse primer) and QuantiTect SYBR Green PCR Master Mix. If a miScript Primer Assay for the small RNA of interest is not already available, one can be custom-designed.

Applications

miScript Primer Assays are used as part of the miScript PCR System for:

Mature miRNA quantification
snoRNA detection

Kit Handbooks
2
Name Hs_miR-33_1 miScript Primer Assay (MS00003304)
miRna stem loop
Sanger ID hsa-mir-33a
Sanger Accession MI0000091
Description Homo sapiens miR-33a stem-loop
Sequence CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGUGGUAC
CCAUGCAAUGUUUCCACAGUGCAUCACAG
mature miRNA
Sanger ID hsa-miR-33a-5p
Sanger Accession MIMAT0000091
Sequence GUGCAUUGUAGUUGCAUUGCA
miRNAs amplified by this miScript Primer Assay: hsa-miR-33a-5p